Variant report

Variant	rs549749525
Chromosome Location	chr19:42022296-42022297
allele	-/TGTACACTTCCCACCATATGGGGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 16 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:16 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv510767	chr19:41962486-42049165	Active TSS Enhancers Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Weak transcription Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
2	nsv911770	chr19:41962486-42066279	Active TSS Flanking Active TSS Bivalent/Poised TSS Enhancers Weak transcription Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
3	nsv911771	chr19:41962486-42085873	Enhancers Flanking Active TSS Weak transcription ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
4	nsv1055515	chr19:41968797-42057334	Enhancers Flanking Active TSS Weak transcription Bivalent Enhancer Bivalent/Poised TSS Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
5	esv3376048	chr19:41969544-42022873	Active TSS Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Bivalent Enhancer Enhancers ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
6	esv3497342	chr19:41969692-42023108	Enhancers Active TSS ZNF genes & repeats Flanking Active TSS Weak transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
7	esv3497343	chr19:41969692-42023108	Weak transcription Active TSS Flanking Active TSS Enhancers Bivalent/Poised TSS Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
8	esv3319145	chr19:41971761-42025822	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Active TSS Bivalent/Poised TSS ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
9	esv3319144	chr19:41971770-42026041	Weak transcription Enhancers Bivalent/Poised TSS Active TSS Flanking Active TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
10	nsv1060959	chr19:41976648-42023361	Enhancers Bivalent Enhancer Weak transcription Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
11	nsv1057764	chr19:41976648-42023588	Bivalent/Poised TSS Enhancers Flanking Active TSS Weak transcription Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
12	esv2760512	chr19:41976660-42023600	Enhancers Active TSS Bivalent Enhancer Weak transcription ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
13	nsv911772	chr19:41985624-42066279	Bivalent Enhancer Active TSS Enhancers Flanking Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
14	nsv911773	chr19:42001210-42085873	Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Active TSS Strong transcription Bivalent/Poised TSS Weak transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
15	nsv579601	chr19:42006714-42031592	Flanking Active TSS Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Weak transcription	TF binding region CpG island	3 gene(s)	inside rSNPs	diseases
16	nsv579602	chr19:42015468-42047924	Flanking Active TSS Bivalent Enhancer Enhancers Bivalent/Poised TSS Active TSS ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:2 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr19:42022200-42022400	Bivalent Enhancer	Primary B cells from cord blood	blood
2	chr19:42022200-42023000	Enhancers	Primary B cells from peripheral blood	blood

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links