Variant report

Variant rs553148193
Chromosome Location chr3:52931233-52931234
allele -/GGAGGGGCCCCCAGGGGGGCCG
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr3:52929800-52931400 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
2 chr3:52929800-52932200 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
3 chr3:52929800-52932200 Flanking Active TSS Primary hematopoietic stem cells blood
4 chr3:52930000-52931400 Flanking Active TSS Primary hematopoietic stem cells short term culture blood
5 chr3:52930000-52931400 Flanking Active TSS Skeletal Muscle Female skeletal muscle
6 chr3:52930000-52932000 Active TSS H9 Cell Line embryonic stem cell
7 chr3:52930000-52932200 Active TSS HUES64 Cell Line embryonic stem cell
8 chr3:52930000-52932200 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Female --
9 chr3:52930200-52931400 Flanking Active TSS Primary neutrophils fromperipheralblood blood
10 chr3:52930200-52931400 Flanking Active TSS Foreskin Fibroblast Primary Cells skin02 Skin
11 chr3:52930200-52932000 Active TSS HUES6 Cell Line embryonic stem cell
12 chr3:52930200-52932000 Active TSS Right Atrium heart
13 chr3:52930200-52932200 Active TSS HUES48 Cell Line embryonic stem cell
14 chr3:52930200-52932200 Active TSS IMR90 fetal lung fibroblasts Cell Line lung
15 chr3:52930200-52932200 Active TSS GM12878-XiMat blood
16 chr3:52930400-52931400 Flanking Active TSS Brain Germinal Matrix brain
17 chr3:52930400-52931800 Flanking Active TSS Primary mononuclear cells fromperipheralblood Blood
18 chr3:52930400-52931800 Active TSS HepG2 liver
19 chr3:52930400-52932000 Active TSS ES-I3 Cell Line embryonic stem cell
20 chr3:52930400-52932000 Active TSS iPS-15b Cell Line embryonic stem cell
21 chr3:52930400-52932000 Active TSS iPS-20b Cell Line embryonic stem cell
22 chr3:52930400-52932000 Active TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
23 chr3:52930400-52932000 Active TSS Aorta Aorta
24 chr3:52930400-52932200 Active TSS H1 Cell Line embryonic stem cell
25 chr3:52930400-52932200 Active TSS Fetal Kidney kidney
26 chr3:52930400-52932200 Active TSS Pancreatic Islets Pancreatic Islet
27 chr3:52930400-52932200 Active TSS Ovary ovary
28 chr3:52930600-52931400 Transcr. at gene 5' and 3' Primary T helper 17 cells PMA-I stimulated --
29 chr3:52930600-52931400 Flanking Active TSS Liver Liver
30 chr3:52930600-52931800 Active TSS Brain Dorsolateral Prefrontal Cortex brain
31 chr3:52930600-52931800 Active TSS HSMMtube muscle
32 chr3:52930600-52932000 Active TSS ES-WA7 Cell Line embryonic stem cell
33 chr3:52930600-52932000 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
34 chr3:52930600-52932000 Active TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
35 chr3:52930600-52932000 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
36 chr3:52930600-52932000 Flanking Active TSS Primary B cells from cord blood blood
37 chr3:52930800-52931400 Transcr. at gene 5' and 3' Primary T helper naive cells fromperipheralblood blood
38 chr3:52930800-52931800 Active TSS Primary T helper naive cells from peripheral blood blood
39 chr3:52930800-52931800 Active TSS Muscle Satellite Cultured Cells --
40 chr3:52930800-52931800 Active TSS Rectal Smooth Muscle rectum
41 chr3:52930800-52931800 Active TSS Stomach Mucosa stomach
42 chr3:52930800-52931800 Active TSS HMEC breast
43 chr3:52930800-52932000 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
44 chr3:52930800-52932000 Active TSS iPS-18 Cell Line embryonic stem cell
45 chr3:52930800-52932000 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
46 chr3:52930800-52932000 Active TSS Esophagus oesophagus
47 chr3:52930800-52932000 Active TSS A549 lung
48 chr3:52930800-52932200 Active TSS NHLF lung
49 chr3:52931000-52931600 Active TSS Gastric stomach
50 chr3:52931000-52931800 Active TSS H9 Derived Neuronal Progenitor Cultured Cells ES cell derived

Quick Search:


  
Input of quick search could be:

what's new

Quick links