Variant report

Variant	rs554803874
Chromosome Location	chr15:74046299-74046300
allele	-/AGTAGGGAAGTGTGGGTTGGGTGGTGC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	ZNF263	chr15:74046058-74047144	HEK293-T-REx	kidney:	n/a	chr15:74046382-74046403
2	TEAD4	chr15:74046161-74046686	H1-hESC	embryonic stem cell:	n/a	n/a
3	CHD2	chr15:74046208-74046595	H1-hESC	embryonic stem cell:	n/a	n/a
4	SIN3A	chr15:74046209-74046540	H1-hESC	embryonic stem cell:	n/a	n/a
5	ZNF143	chr15:74046235-74046503	H1-hESC	embryonic stem cell:	n/a	n/a
6	POLR2A	chr15:74046230-74046420	H1-hESC	embryonic stem cell:	n/a	n/a
7	SP1	chr15:74046165-74046697	H1-hESC	embryonic stem cell:	n/a	chr15:74046444-74046455
8	JUND	chr15:74046041-74046570	H1-hESC	embryonic stem cell:	n/a	n/a
9	GTF2F1	chr15:74046253-74046302	H1-hESC	embryonic stem cell:	n/a	n/a
10	TEAD4	chr15:74046164-74046639	H1-hESC	embryonic stem cell:	n/a	n/a
11	CTCF	chr15:74046288-74046318	Kidney_OC	kidney:	n/a	n/a

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr15:74046017..74047520-chr15:74054449..74056140,2	MCF-7	breast:

Variant related genes	Relation type
C15orf59	TF binding region

Extended variants
information (count: 5 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:5 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv471252	chr15:74006691-74089793	Bivalent/Poised TSS Weak transcription Flanking Active TSS Enhancers Genic enhancers Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
2	nsv569970	chr15:74016622-74059081	Weak transcription Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Genic enhancers Active TSS Bivalent/Poised TSS Strong transcription Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
3	esv3421437	chr15:74043924-74046872	Flanking Active TSS Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Active TSS Bivalent Enhancer Enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
4	esv9813	chr15:74044169-74048692	Active TSS Enhancers Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Flanking Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
5	esv3418540	chr15:74044749-74046697	Flanking Active TSS Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:36 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr15:74045200-74046600	Bivalent Enhancer	Skeletal Muscle Male	skeletal muscle
2	chr15:74045600-74046400	Bivalent Enhancer	H1 Derived Mesenchymal Stem Cells	ES cell derived
3	chr15:74045600-74046400	Enhancers	Brain Cingulate Gyrus	brain
4	chr15:74045800-74046400	Bivalent Enhancer	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
5	chr15:74045800-74046400	Flanking Bivalent TSS/Enh	HUES6 Cell Line	embryonic stem cell
6	chr15:74045800-74046400	Flanking Active TSS	Cortex derived primary cultured neurospheres	brain
7	chr15:74045800-74046600	Flanking Active TSS	iPS-15b Cell Line	embryonic stem cell
8	chr15:74045800-74046600	Flanking Bivalent TSS/Enh	iPS-18 Cell Line	embryonic stem cell
9	chr15:74045800-74046600	Enhancers	Fetal Brain Male	brain
10	chr15:74045800-74047200	Bivalent Enhancer	Fetal Lung	lung
11	chr15:74046000-74046400	Flanking Bivalent TSS/Enh	H1 Cell Line	embryonic stem cell
12	chr15:74046000-74046400	Flanking Bivalent TSS/Enh	HUES48 Cell Line	embryonic stem cell
13	chr15:74046000-74046400	Flanking Bivalent TSS/Enh	iPS-20b Cell Line	embryonic stem cell
14	chr15:74046000-74046400	Bivalent Enhancer	Duodenum Smooth Muscle	Duodenum
15	chr15:74046000-74046400	Bivalent Enhancer	Fetal Muscle Trunk	muscle
16	chr15:74046000-74046400	Enhancers	Right Ventricle	heart
17	chr15:74046000-74046600	Bivalent Enhancer	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
18	chr15:74046000-74046600	Bivalent Enhancer	Fetal Stomach	stomach
19	chr15:74046000-74046800	Flanking Active TSS	ES-I3 Cell Line	embryonic stem cell
20	chr15:74046000-74046800	Enhancers	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
21	chr15:74046000-74046800	Flanking Bivalent TSS/Enh	HUES64 Cell Line	embryonic stem cell
22	chr15:74046000-74047000	Enhancers	Fetal Brain Female	brain
23	chr15:74046000-74047000	Bivalent Enhancer	Fetal Muscle Leg	muscle
24	chr15:74046000-74047200	Enhancers	ES-UCSF4 Cell Line	embryonic stem cell
25	chr15:74046000-74047400	Enhancers	iPS DF 6.9 Cell Line	embryonic stem cell
26	chr15:74046000-74056200	Weak transcription	Right Atrium	heart
27	chr15:74046200-74046400	Weak transcription	ES-WA7 Cell Line	embryonic stem cell
28	chr15:74046200-74046400	Active TSS	H9 Cell Line	embryonic stem cell
29	chr15:74046200-74046400	Bivalent Enhancer	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
30	chr15:74046200-74046400	Enhancers	Ganglion Eminence derived primary cultured neurospheres	brain
31	chr15:74046200-74046400	Bivalent Enhancer	Brain Hippocampus Middle	brain
32	chr15:74046200-74046400	Bivalent Enhancer	Stomach Smooth Muscle	stomach
33	chr15:74046200-74046600	Weak transcription	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
34	chr15:74046200-74046600	Enhancers	iPS DF 19.11 Cell Line	embryonic stem cell
35	chr15:74046200-74047000	Enhancers	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
36	chr15:74046200-74047000	Bivalent Enhancer	H9 Derived Neuron Cultured Cells	ES cell derived

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links