Variant report

Variant	rs555150964
Chromosome Location	chr7:27407654-27407655
allele	-/ACCACACATTAACACATACCACACACAC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 3 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:3 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv531024	chr7:27194426-27461954	Enhancers Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Weak transcription Transcr. at gene 5' and 3' Genic enhancers ZNF genes & repeats Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	148 gene(s)	inside rSNPs	diseases
2	nsv830930	chr7:27395838-27587355	Weak transcription Enhancers Strong transcription ZNF genes & repeats Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	17 gene(s)	inside rSNPs	diseases
3	esv3340965	chr7:27406477-27408975	Weak transcription Enhancers Genic enhancers ZNF genes & repeats Bivalent Enhancer	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:9 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr7:27404200-27411800	Weak transcription	K562	blood
2	chr7:27404800-27415000	Weak transcription	Right Atrium	heart
3	chr7:27407400-27407800	Genic enhancers	Pancreas	Pancrea
4	chr7:27407400-27407800	Enhancers	Spleen	Spleen
5	chr7:27407600-27408000	ZNF genes & repeats	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
6	chr7:27407600-27408000	ZNF genes & repeats	Fetal Kidney	kidney
7	chr7:27407600-27408000	Bivalent Enhancer	Sigmoid Colon	Sigmoid Colon
8	chr7:27407600-27408200	ZNF genes & repeats	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
9	chr7:27407600-27408200	Enhancers	H1 Derived Mesenchymal Stem Cells	ES cell derived

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links