Variant report

Variant	rs555860989
Chromosome Location	chr21:45758930-45758931
allele	-/CCGGCTCCGCCCTCGCCCCGCC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	POLR2A	chr21:45758845-45759807	Hela-S3	cervix:	n/a	n/a
2	POLR2A	chr21:45755743-45759333	K562	blood:	n/a	n/a
3	MYC	chr21:45758922-45759860	K562	blood:	n/a	n/a
4	YY1	chr21:45758899-45759667	GM12878	blood:	n/a	chr21:45758972-45758986
5	POLR2A	chr21:45758878-45759720	H1-neurons	neurons:	n/a	n/a
6	POLR2A	chr21:45758909-45759631	PANC-1	pancreas:	n/a	n/a
7	POLR2A	chr21:45758862-45759908	PFSK-1	brain:	n/a	n/a
8	YY1	chr21:45758915-45759832	H1-hESC	embryonic stem cell:	n/a	chr21:45758972-45758986
9	MAX	chr21:45758927-45759687	Hela-S3	cervix:	n/a	n/a
10	POLR2A	chr21:45758892-45759860	K562	blood:	n/a	n/a
11	POLR2A	chr21:45758859-45759741	K562	blood:	n/a	n/a
12	YY1	chr21:45758893-45759583	ECC-1	luminal epithelium:	n/a	chr21:45758972-45758986
13	NRF1	chr21:45758847-45759612	GM12878	blood:	n/a	n/a
14	ELF1	chr21:45758888-45759756	MCF-7	breast:	n/a	n/a
15	POLR2A	chr21:45758874-45759603	HepG2	liver:	n/a	n/a
16	JUND	chr21:45758918-45759547	A549	lung:	n/a	chr21:45759464-45759475
17	MXI1	chr21:45758824-45760305	SK-N-SH	brain:	n/a	n/a
18	CREB1	chr21:45758927-45759817	GM12878	blood:	n/a	n/a
19	POLR2A	chr21:45758810-45759782	HUVEC	blood vessel:	n/a	n/a
20	POLR2A	chr21:45758910-45759837	GM12891	blood:	n/a	n/a
21	POLR2A	chr21:45758907-45759966	GM12878	blood:	n/a	n/a
22	MYC	chr21:45758920-45759576	K562	blood:	n/a	n/a
23	TCF3	chr21:45758871-45759565	GM12878	blood:	n/a	chr21:45759357-45759371
24	POLR2A	chr21:45758891-45760119	SK-N-SH	brain:	n/a	n/a
25	POLR2A	chr21:45758885-45759919	GM19099	blood:	n/a	n/a
26	POLR2A	chr21:45758917-45759817	K562	blood:	n/a	n/a
27	PML	chr21:45758908-45759708	K562	blood:	n/a	n/a
28	MAZ	chr21:45758840-45759788	K562	blood:	n/a	n/a
29	SP4	chr21:45758708-45759601	H1-hESC	embryonic stem cell:	n/a	chr21:45759157-45759168
30	TAF1	chr21:45758912-45759838	ECC-1	luminal epithelium:	n/a	n/a
31	CREB1	chr21:45758907-45760034	GM12878	blood:	n/a	n/a
32	YY1	chr21:45758898-45759526	GM12891	blood:	n/a	chr21:45758972-45758986
33	TAF1	chr21:45758835-45759680	H1-hESC	embryonic stem cell:	n/a	n/a
34	YY1	chr21:45758926-45759503	HepG2	liver:	n/a	chr21:45758972-45758986
35	MAX	chr21:45758920-45759634	NB4	blood:	n/a	n/a
36	PML	chr21:45758928-45759670	MCF-7	breast:	n/a	n/a
37	CREB1	chr21:45758893-45759659	ECC-1	luminal epithelium:	n/a	n/a
38	CEBPD	chr21:45758886-45759529	HepG2	liver:	n/a	n/a
39	SP1	chr21:45758765-45759628	A549	lung:	n/a	chr21:45759158-45759168 chr21:45759157-45759168 chr21:45759158-45759168 chr21:45759157-45759169 chr21:45759158-45759167 chr21:45758989-45758998 chr21:45759159-45759168 chr21:45759157-45759169 chr21:45759159-45759168
40	REST	chr21:45758921-45759698	HL-60	blood:	n/a	n/a
41	POLR2A	chr21:45758923-45759829	SK-N-SH	brain:	n/a	n/a
42	ELF1	chr21:45758820-45759674	K562	blood:	n/a	n/a
43	POLR2A	chr21:45758918-45760138	GM12892	blood:	n/a	n/a
44	SP1	chr21:45758328-45759541	GM12878	blood:	n/a	chr21:45759158-45759168 chr21:45759157-45759168 chr21:45759158-45759168 chr21:45759157-45759169 chr21:45759158-45759167 chr21:45758989-45758998 chr21:45759159-45759168 chr21:45759157-45759169 chr21:45759159-45759168
45	TAF1	chr21:45758854-45759617	PFSK-1	brain:	n/a	n/a
46	TAF1	chr21:45758930-45759609	K562	blood:	n/a	n/a
47	ELF1	chr21:45758842-45759903	MCF-7	breast:	n/a	n/a
48	TAF1	chr21:45758846-45759661	K562	blood:	n/a	n/a
49	POLR2A	chr21:45758915-45759568	HepG2	liver:	n/a	n/a
50	MXI1	chr21:45758919-45760062	IMR90	lung:	n/a	n/a

No.	Distal block	Cell Line	Cell type
1	chr21:45719852..45723806-chr21:45756512..45759776,5	MCF-7	breast:
2	chr21:45137459..45139006-chr21:45757903..45760574,2	K562	blood:
3	chr21:45758316..45760568-chr21:45903461..45906076,2	MCF-7	breast:
4	chr21:45758282..45760774-chr21:46492663..46495375,2	K562	blood:
5	chr21:45534290..45536622-chr21:45758168..45760821,2	MCF-7	breast:
6	chr21:45758776..45759711-chr5:43483543..43484104,2	Hela-S3	cervix:
7	chr21:45553374..45555215-chr21:45757736..45759429,2	K562	blood:
8	chr21:45552120..45555319-chr21:45756917..45761085,4	MCF-7	breast:
9	chr21:45525373..45527219-chr21:45757637..45759650,2	K562	blood:
10	chr21:45758503..45759276-chr5:33440044..33440944,2	Hela-S3	cervix:
11	chr21:45757779..45764116-chr21:45768144..45773804,8	K562	blood:
12	chr10:102295304..102296047-chr21:45758837..45759535,2	Hela-S3	cervix:
13	chr21:45525933..45529754-chr21:45756924..45759975,4	MCF-7	breast:
14	chr21:45756335..45760049-chr21:45874026..45878349,7	MCF-7	breast:
15	chr21:45758851..45761192-chr21:45902340..45905536,3	K562	blood:
16	chr21:45757587..45760440-chr21:45787714..45792009,6	MCF-7	breast:

Variant related genes	Relation type
ENSG00000232969	TF binding region
C21orf2	TF binding region
ENSG00000160233	Chromatin interaction
ENSG00000229356	Chromatin interaction
ENSG00000141959	Chromatin interaction
ENSG00000249572	Chromatin interaction
ENSG00000235374	Chromatin interaction
ENSG00000260256	Chromatin interaction
ENSG00000160209	Chromatin interaction
ENSG00000241945	Chromatin interaction
ENSG00000228709	Chromatin interaction
ENSG00000249492	Chromatin interaction
ENSG00000160221	Chromatin interaction
ENSG00000268856	Chromatin interaction
ENSG00000113407	Chromatin interaction
ENSG00000197381	Chromatin interaction
ENSG00000166135	Chromatin interaction
ENSG00000142185	Chromatin interaction
ENSG00000151881	Chromatin interaction

Extended variants
information (count: 49 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:49 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv33817	chr21:45169412-46031810	Weak transcription Bivalent/Poised TSS Enhancers Flanking Active TSS Strong transcription Genic enhancers Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	121 gene(s)	inside rSNPs	diseases
2	nsv1064420	chr21:45460089-45814986	Enhancers Weak transcription Active TSS Strong transcription Flanking Bivalent TSS/Enh Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	67 gene(s)	inside rSNPs	diseases
3	nsv544472	chr21:45460089-45814986	Weak transcription Flanking Bivalent TSS/Enh Enhancers Strong transcription Bivalent Enhancer Active TSS Genic enhancers Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	67 gene(s)	inside rSNPs	diseases
4	nsv432155	chr21:45479055-45772388	Weak transcription Enhancers Bivalent Enhancer Strong transcription Flanking Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Genic enhancers Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	66 gene(s)	inside rSNPs	diseases
5	esv1817474	chr21:45540607-45773102	Weak transcription Flanking Active TSS Enhancers Bivalent Enhancer Genic enhancers Bivalent/Poised TSS Active TSS Strong transcription Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	65 gene(s)	inside rSNPs	diseases
6	nsv533679	chr21:45551026-45768578	Enhancers Active TSS Weak transcription Bivalent Enhancer Genic enhancers Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	64 gene(s)	inside rSNPs	diseases
7	nsv913898	chr21:45555079-45941566	Weak transcription Enhancers Active TSS Strong transcription Genic enhancers Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	74 gene(s)	inside rSNPs	diseases
8	nsv428042	chr21:45560437-45848190	Enhancers Active TSS Genic enhancers Weak transcription Flanking Active TSS Strong transcription Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	61 gene(s)	inside rSNPs	diseases
9	nsv459295	chr21:45629565-45849864	Genic enhancers Enhancers Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Active TSS Strong transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	57 gene(s)	inside rSNPs	diseases
10	nsv587740	chr21:45629565-45849864	Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS Strong transcription Genic enhancers Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	57 gene(s)	inside rSNPs	diseases
11	nsv913906	chr21:45657970-45818609	Flanking Bivalent TSS/Enh Flanking Active TSS Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Enhancers Active TSS Weak transcription ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	51 gene(s)	inside rSNPs	diseases
12	esv3361489	chr21:45669073-46013747	Weak transcription Enhancers Flanking Active TSS Strong transcription Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	69 gene(s)	inside rSNPs	diseases
13	nsv913910	chr21:45681153-45787250	Bivalent Enhancer Active TSS Enhancers Weak transcription Strong transcription Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
14	nsv913911	chr21:45681153-45893907	Bivalent Enhancer Flanking Bivalent TSS/Enh Strong transcription Weak transcription ZNF genes & repeats Enhancers Flanking Active TSS Active TSS Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	55 gene(s)	inside rSNPs	diseases
15	nsv913912	chr21:45687581-45768598	Flanking Active TSS Weak transcription Bivalent/Poised TSS Active TSS Enhancers Strong transcription Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
16	nsv913913	chr21:45687581-45787250	Strong transcription Active TSS Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
17	nsv913917	chr21:45697755-45787250	Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS Weak transcription Bivalent Enhancer Enhancers Bivalent/Poised TSS Strong transcription Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
18	nsv913918	chr21:45697755-45941566	Weak transcription ZNF genes & repeats Bivalent/Poised TSS Flanking Active TSS Active TSS Strong transcription Enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	60 gene(s)	inside rSNPs	diseases
19	nsv913920	chr21:45699404-45824792	Weak transcription Strong transcription Active TSS Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
20	nsv913921	chr21:45699404-45854431	Enhancers Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Genic enhancers Strong transcription Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	50 gene(s)	inside rSNPs	diseases
21	nsv913922	chr21:45699404-45893907	Genic enhancers Enhancers Strong transcription Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	55 gene(s)	inside rSNPs	diseases
22	nsv913926	chr21:45700641-45764397	Active TSS Weak transcription Flanking Active TSS Strong transcription Enhancers Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
23	nsv913927	chr21:45700641-45787250	Weak transcription Flanking Active TSS Enhancers Genic enhancers Active TSS Strong transcription ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
24	nsv913928	chr21:45700641-45811343	Weak transcription Enhancers Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats Flanking Active TSS Active TSS Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
25	nsv913929	chr21:45700641-45860912	Weak transcription Enhancers Flanking Active TSS Strong transcription Bivalent Enhancer Active TSS Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	50 gene(s)	inside rSNPs	diseases
26	nsv913930	chr21:45700641-45893907	ZNF genes & repeats Weak transcription Strong transcription Enhancers Flanking Active TSS Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	55 gene(s)	inside rSNPs	diseases
27	nsv913931	chr21:45703660-45764397	Bivalent Enhancer Weak transcription Enhancers Flanking Active TSS Strong transcription Active TSS Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
28	nsv913932	chr21:45703660-45787250	Enhancers Strong transcription Weak transcription Active TSS Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
29	nsv913933	chr21:45703660-45811343	ZNF genes & repeats Active TSS Weak transcription Strong transcription Flanking Active TSS Bivalent Enhancer Genic enhancers Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
30	nsv913935	chr21:45709153-45787250	Bivalent/Poised TSS Flanking Active TSS Strong transcription Enhancers Genic enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
31	nsv913936	chr21:45709153-45811343	Active TSS Flanking Active TSS Enhancers Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
32	nsv913937	chr21:45709153-45865167	Genic enhancers Active TSS Enhancers Weak transcription Strong transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	50 gene(s)	inside rSNPs	diseases
33	nsv913938	chr21:45712588-45787250	Bivalent Enhancer Active TSS Flanking Active TSS Enhancers Weak transcription Strong transcription ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
34	nsv913939	chr21:45712588-45818609	Weak transcription Bivalent Enhancer Active TSS Flanking Active TSS Strong transcription Enhancers Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
35	nsv913940	chr21:45712588-45893907	Strong transcription Bivalent Enhancer Weak transcription Flanking Active TSS Enhancers Flanking Bivalent TSS/Enh Active TSS Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	55 gene(s)	inside rSNPs	diseases
36	nsv587780	chr21:45722442-45764397	Weak transcription Genic enhancers Strong transcription Active TSS Enhancers Transcr. at gene 5' and 3' Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	32 gene(s)	inside rSNPs	diseases
37	nsv913941	chr21:45722442-45885589	ZNF genes & repeats Flanking Active TSS Enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Weak transcription Active TSS Bivalent/Poised TSS Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	39 gene(s)	inside rSNPs	diseases
38	nsv1058359	chr21:45724055-45941566	Transcr. at gene 5' and 3' Weak transcription Flanking Active TSS Bivalent Enhancer Strong transcription Enhancers ZNF genes & repeats Bivalent/Poised TSS Active TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	48 gene(s)	inside rSNPs	diseases
39	nsv1065203	chr21:45731690-45941566	Strong transcription Enhancers Flanking Active TSS Bivalent Enhancer Weak transcription Active TSS Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	44 gene(s)	inside rSNPs	diseases
40	nsv544473	chr21:45731690-45941566	Flanking Active TSS Weak transcription Strong transcription Enhancers Bivalent Enhancer Active TSS Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	44 gene(s)	inside rSNPs	diseases
41	nsv913942	chr21:45740823-45941566	Strong transcription ZNF genes & repeats Weak transcription Enhancers Genic enhancers Flanking Active TSS Bivalent Enhancer Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	43 gene(s)	inside rSNPs	diseases
42	nsv913943	chr21:45740823-46031810	Enhancers Bivalent Enhancer Active TSS Flanking Active TSS Strong transcription Weak transcription Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	52 gene(s)	inside rSNPs	diseases
43	nsv1059107	chr21:45749304-45813036	Weak transcription ZNF genes & repeats Enhancers Bivalent Enhancer Bivalent/Poised TSS Flanking Active TSS Active TSS Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
44	nsv828909	chr21:45755663-45770002	Enhancers Flanking Active TSS Weak transcription Active TSS Bivalent/Poised TSS Strong transcription Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	22 gene(s)	inside rSNPs	diseases
45	esv3422475	chr21:45757549-45760697	Enhancers Flanking Active TSS Active TSS Weak transcription Strong transcription Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	22 gene(s)	inside rSNPs	diseases
46	nsv1067264	chr21:45757599-45941566	ZNF genes & repeats Flanking Active TSS Enhancers Weak transcription Bivalent/Poised TSS Strong transcription Bivalent Enhancer Active TSS Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	40 gene(s)	inside rSNPs	diseases
47	nsv544474	chr21:45757599-45941566	Bivalent/Poised TSS Weak transcription Strong transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	40 gene(s)	inside rSNPs	diseases
48	nsv913944	chr21:45757905-45941566	Flanking Active TSS Bivalent Enhancer Weak transcription Bivalent/Poised TSS Enhancers Active TSS Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	40 gene(s)	inside rSNPs	diseases
49	esv3431505	chr21:45757974-45759872	Enhancers Weak transcription Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:126 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr21:45743000-45759000	Weak transcription	Primary B cells from cord blood	blood
2	chr21:45745400-45759000	Weak transcription	Small Intestine	intestine
3	chr21:45756800-45759000	Weak transcription	Primary T cells effector/memory enriched fromperipheralblood	blood
4	chr21:45757200-45759000	Weak transcription	Lung	lung
5	chr21:45757400-45759000	Weak transcription	Primary T cells from cord blood	blood
6	chr21:45757800-45759400	Active TSS	Rectal Smooth Muscle	rectum
7	chr21:45757800-45759600	Active TSS	HUES48 Cell Line	embryonic stem cell
8	chr21:45758000-45759000	Enhancers	Primary Natural Killer cells fromperipheralblood	blood
9	chr21:45758000-45759600	Active TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
10	chr21:45758000-45759600	Active TSS	iPS-18 Cell Line	embryonic stem cell
11	chr21:45758000-45759600	Active TSS	NHEK	skin
12	chr21:45758000-45760000	Active TSS	ES-I3 Cell Line	embryonic stem cell
13	chr21:45758000-45760000	Active TSS	iPS-20b Cell Line	embryonic stem cell
14	chr21:45758000-45760200	Active TSS	Foreskin Keratinocyte Primary Cells skin03	Skin
15	chr21:45758200-45759000	Enhancers	Primary mononuclear cells fromperipheralblood	Blood
16	chr21:45758200-45759400	Active TSS	HepG2	liver
17	chr21:45758200-45759600	Active TSS	HUES64 Cell Line	embryonic stem cell
18	chr21:45758200-45759600	Active TSS	iPS-15b Cell Line	embryonic stem cell
19	chr21:45758200-45759600	Active TSS	Breast Myoepithelial Primary Cells	Breast
20	chr21:45758200-45759600	Active TSS	Brain Germinal Matrix	brain
21	chr21:45758200-45759600	Active TSS	Thymus	Thymus
22	chr21:45758200-45759800	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
23	chr21:45758200-45759800	Active TSS	Foreskin Fibroblast Primary Cells skin01	Skin
24	chr21:45758200-45759800	Active TSS	Aorta	Aorta
25	chr21:45758200-45759800	Active TSS	Colon Smooth Muscle	Colon
26	chr21:45758200-45759800	Active TSS	Fetal Kidney	kidney
27	chr21:45758200-45759800	Active TSS	Psoas Muscle	Psoas
28	chr21:45758200-45759800	Active TSS	Rectal Mucosa Donor 29	rectum
29	chr21:45758200-45759800	Active TSS	A549	lung
30	chr21:45758200-45760000	Active TSS	H9 Cell Line	embryonic stem cell
31	chr21:45758200-45760000	Active TSS	Pancreatic Islets	Pancreatic Islet
32	chr21:45758200-45760200	Active TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
33	chr21:45758200-45760200	Active TSS	Foreskin Fibroblast Primary Cells skin02	Skin
34	chr21:45758400-45759000	Weak transcription	Primary T helper memory cells from peripheral blood 2	blood
35	chr21:45758400-45759000	Weak transcription	Primary T helper naive cells from peripheral blood	blood
36	chr21:45758400-45759000	Weak transcription	Primary T killer memory cells from peripheral blood	blood
37	chr21:45758400-45759000	Weak transcription	Esophagus	oesophagus
38	chr21:45758400-45759000	Weak transcription	Placenta Amnion	Placenta Amnion
39	chr21:45758400-45759000	Weak transcription	Sigmoid Colon	Sigmoid Colon
40	chr21:45758400-45759000	Weak transcription	Stomach Mucosa	stomach
41	chr21:45758400-45759000	Weak transcription	Spleen	Spleen
42	chr21:45758400-45759400	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
43	chr21:45758400-45759400	Active TSS	Primary neutrophils fromperipheralblood	blood
44	chr21:45758400-45759400	Active TSS	Primary T helper naive cells fromperipheralblood	blood
45	chr21:45758400-45759400	Active TSS	Primary T helper 17 cells PMA-I stimulated	--
46	chr21:45758400-45759400	Active TSS	Primary T helper cells fromperipheralblood	blood
47	chr21:45758400-45759400	Active TSS	Primary T regulatory cells fromperipheralblood	blood
48	chr21:45758400-45759400	Active TSS	Ganglion Eminence derived primary cultured neurospheres	brain
49	chr21:45758400-45759400	Active TSS	Adipose Nuclei	Adipose
50	chr21:45758400-45759400	Active TSS	Liver	Liver

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links