Variant report

Variant rs557208605
Chromosome Location chr5:74346538-74346539
allele -/CTCTCACACCCTACACAAAACTCATCTG
Outlinks Ensembl   UCSC
Chromatin state (count:101 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr5:74329200-74346800 Weak transcription Foreskin Melanocyte Primary Cells skin01 Skin
2 chr5:74330600-74348000 Weak transcription Primary hematopoietic stem cells blood
3 chr5:74331600-74347000 Weak transcription Placenta Amnion Placenta Amnion
4 chr5:74337600-74348200 Weak transcription Left Ventricle heart
5 chr5:74338600-74348000 Weak transcription Psoas Muscle Psoas
6 chr5:74339000-74347000 Weak transcription hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
7 chr5:74340600-74347400 Weak transcription Foreskin Melanocyte Primary Cells skin03 Skin
8 chr5:74341400-74347400 Enhancers HMEC breast
9 chr5:74342200-74347800 Enhancers Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
10 chr5:74343800-74346800 Weak transcription Primary hematopoietic stem cells short term culture blood
11 chr5:74343800-74346800 Enhancers Fetal Brain Female brain
12 chr5:74344000-74346800 Enhancers Stomach Mucosa stomach
13 chr5:74344200-74347200 Enhancers hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
14 chr5:74344400-74346800 Enhancers Rectal Smooth Muscle rectum
15 chr5:74344400-74347200 Enhancers Fetal Brain Male brain
16 chr5:74344400-74348000 Weak transcription Right Atrium heart
17 chr5:74344600-74346600 Weak transcription Duodenum Smooth Muscle Duodenum
18 chr5:74344600-74346800 Enhancers Breast Myoepithelial Primary Cells Breast
19 chr5:74344600-74347000 Enhancers Foreskin Fibroblast Primary Cells skin01 Skin
20 chr5:74344600-74347400 Weak transcription Brain Cingulate Gyrus brain
21 chr5:74344800-74346800 Weak transcription Primary mononuclear cells fromperipheralblood Blood
22 chr5:74344800-74347400 Weak transcription Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
23 chr5:74344800-74347400 Weak transcription Brain Hippocampus Middle brain
24 chr5:74344800-74347800 Flanking Active TSS Primary T regulatory cells fromperipheralblood blood
25 chr5:74344800-74347800 Weak transcription Osteobl bone
26 chr5:74344800-74348000 Weak transcription HSMMtube muscle
27 chr5:74344800-74348400 Enhancers Spleen Spleen
28 chr5:74345000-74346800 Weak transcription Aorta Aorta
29 chr5:74345000-74347000 Weak transcription Brain Anterior Caudate brain
30 chr5:74345200-74346600 Flanking Active TSS Thymus Thymus
31 chr5:74345200-74347200 Enhancers Primary hematopoietic stem cells G-CSF-mobilized Female --
32 chr5:74345200-74347400 Enhancers Placenta Placenta
33 chr5:74345200-74347600 Weak transcription Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
34 chr5:74345400-74346800 Enhancers Rectal Mucosa Donor 29 rectum
35 chr5:74345400-74347000 Enhancers IMR90 fetal lung fibroblasts Cell Line lung
36 chr5:74345400-74347000 Weak transcription Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
37 chr5:74345400-74347000 Enhancers Rectal Mucosa Donor 31 rectum
38 chr5:74345400-74347200 Enhancers Primary T helper 17 cells PMA-I stimulated --
39 chr5:74345400-74347200 Enhancers Primary hematopoietic stem cells G-CSF-mobilized Male --
40 chr5:74345400-74347600 Flanking Active TSS Primary T cells from cord blood blood
41 chr5:74345400-74347600 Flanking Active TSS Primary T helper naive cells fromperipheralblood blood
42 chr5:74345400-74348000 Flanking Active TSS Duodenum Mucosa Duodenum
43 chr5:74345600-74346600 Enhancers NHEK skin
44 chr5:74345600-74346800 Enhancers ES-WA7 Cell Line embryonic stem cell
45 chr5:74345600-74346800 Enhancers iPS DF 6.9 Cell Line embryonic stem cell
46 chr5:74345600-74347000 Weak transcription Cortex derived primary cultured neurospheres brain
47 chr5:74345600-74347000 Active TSS Fetal Kidney kidney
48 chr5:74345600-74347000 Enhancers Pancreas Pancrea
49 chr5:74345600-74347200 Enhancers H1 Derived Mesenchymal Stem Cells ES cell derived
50 chr5:74345600-74347600 Transcr. at gene 5' and 3' Fetal Thymus thymus

Quick Search:


  
Input of quick search could be:

what's new

Quick links