Variant report

Variant	rs557208605
Chromosome Location	chr5:74346538-74346539
allele	-/CTCTCACACCCTACACAAAACTCATCTG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr5:74343721..74346711-chr5:74348510..74350046,2	MCF-7	breast:
2	chr5:74338841..74341157-chr5:74343981..74347541,4	MCF-7	breast:
3	chr5:74341045..74343910-chr5:74344011..74347485,4	MCF-7	breast:
4	chr5:74343645..74345260-chr5:74345382..74347449,2	K562	blood:

Variant related genes	Relation type
ENSG00000250889	Chromatin interaction

Extended variants
information (count: 3 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:3 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1018865	chr5:74246293-74494552	Weak transcription Active TSS Flanking Active TSS Enhancers Bivalent Enhancer Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
2	esv1835096	chr5:74336883-74356857	Enhancers Weak transcription Strong transcription Flanking Active TSS Bivalent Enhancer Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	n/a
3	nsv598654	chr5:74345369-74351228	Active TSS Enhancers Flanking Active TSS Bivalent Enhancer Weak transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	n/a

No data

Chromatin state (count:101 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:74329200-74346800	Weak transcription	Foreskin Melanocyte Primary Cells skin01	Skin
2	chr5:74330600-74348000	Weak transcription	Primary hematopoietic stem cells	blood
3	chr5:74331600-74347000	Weak transcription	Placenta Amnion	Placenta Amnion
4	chr5:74337600-74348200	Weak transcription	Left Ventricle	heart
5	chr5:74338600-74348000	Weak transcription	Psoas Muscle	Psoas
6	chr5:74339000-74347000	Weak transcription	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
7	chr5:74340600-74347400	Weak transcription	Foreskin Melanocyte Primary Cells skin03	Skin
8	chr5:74341400-74347400	Enhancers	HMEC	breast
9	chr5:74342200-74347800	Enhancers	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
10	chr5:74343800-74346800	Weak transcription	Primary hematopoietic stem cells short term culture	blood
11	chr5:74343800-74346800	Enhancers	Fetal Brain Female	brain
12	chr5:74344000-74346800	Enhancers	Stomach Mucosa	stomach
13	chr5:74344200-74347200	Enhancers	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
14	chr5:74344400-74346800	Enhancers	Rectal Smooth Muscle	rectum
15	chr5:74344400-74347200	Enhancers	Fetal Brain Male	brain
16	chr5:74344400-74348000	Weak transcription	Right Atrium	heart
17	chr5:74344600-74346600	Weak transcription	Duodenum Smooth Muscle	Duodenum
18	chr5:74344600-74346800	Enhancers	Breast Myoepithelial Primary Cells	Breast
19	chr5:74344600-74347000	Enhancers	Foreskin Fibroblast Primary Cells skin01	Skin
20	chr5:74344600-74347400	Weak transcription	Brain Cingulate Gyrus	brain
21	chr5:74344800-74346800	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
22	chr5:74344800-74347400	Weak transcription	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
23	chr5:74344800-74347400	Weak transcription	Brain Hippocampus Middle	brain
24	chr5:74344800-74347800	Flanking Active TSS	Primary T regulatory cells fromperipheralblood	blood
25	chr5:74344800-74347800	Weak transcription	Osteobl	bone
26	chr5:74344800-74348000	Weak transcription	HSMMtube	muscle
27	chr5:74344800-74348400	Enhancers	Spleen	Spleen
28	chr5:74345000-74346800	Weak transcription	Aorta	Aorta
29	chr5:74345000-74347000	Weak transcription	Brain Anterior Caudate	brain
30	chr5:74345200-74346600	Flanking Active TSS	Thymus	Thymus
31	chr5:74345200-74347200	Enhancers	Primary hematopoietic stem cells G-CSF-mobilized Female	--
32	chr5:74345200-74347400	Enhancers	Placenta	Placenta
33	chr5:74345200-74347600	Weak transcription	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
34	chr5:74345400-74346800	Enhancers	Rectal Mucosa Donor 29	rectum
35	chr5:74345400-74347000	Enhancers	IMR90 fetal lung fibroblasts Cell Line	lung
36	chr5:74345400-74347000	Weak transcription	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
37	chr5:74345400-74347000	Enhancers	Rectal Mucosa Donor 31	rectum
38	chr5:74345400-74347200	Enhancers	Primary T helper 17 cells PMA-I stimulated	--
39	chr5:74345400-74347200	Enhancers	Primary hematopoietic stem cells G-CSF-mobilized Male	--
40	chr5:74345400-74347600	Flanking Active TSS	Primary T cells from cord blood	blood
41	chr5:74345400-74347600	Flanking Active TSS	Primary T helper naive cells fromperipheralblood	blood
42	chr5:74345400-74348000	Flanking Active TSS	Duodenum Mucosa	Duodenum
43	chr5:74345600-74346600	Enhancers	NHEK	skin
44	chr5:74345600-74346800	Enhancers	ES-WA7 Cell Line	embryonic stem cell
45	chr5:74345600-74346800	Enhancers	iPS DF 6.9 Cell Line	embryonic stem cell
46	chr5:74345600-74347000	Weak transcription	Cortex derived primary cultured neurospheres	brain
47	chr5:74345600-74347000	Active TSS	Fetal Kidney	kidney
48	chr5:74345600-74347000	Enhancers	Pancreas	Pancrea
49	chr5:74345600-74347200	Enhancers	H1 Derived Mesenchymal Stem Cells	ES cell derived
50	chr5:74345600-74347600	Transcr. at gene 5' and 3'	Fetal Thymus	thymus

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links