Variant report

Variant rs561207152
Chromosome Location chr1:161410172-161410173
allele -/CCCGCGCCCCACCGGTGCAAGGCCAG
Outlinks Ensembl   UCSC
Chromatin state (count:119 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:161409000-161410600 Bivalent/Poised TSS HUES64 Cell Line embryonic stem cell
2 chr1:161409200-161410200 Bivalent/Poised TSS Fetal Kidney kidney
3 chr1:161409200-161410200 Enhancers Gastric stomach
4 chr1:161409200-161410200 Enhancers Spleen Spleen
5 chr1:161409200-161410400 Bivalent Enhancer Fetal Brain Male brain
6 chr1:161409200-161410600 Bivalent/Poised TSS iPS-20b Cell Line embryonic stem cell
7 chr1:161409400-161410200 Bivalent/Poised TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
8 chr1:161409400-161410200 Bivalent/Poised TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
9 chr1:161409400-161410200 Bivalent Enhancer Breast Myoepithelial Primary Cells Breast
10 chr1:161409400-161410200 Bivalent Enhancer Primary monocytes fromperipheralblood blood
11 chr1:161409400-161410200 Bivalent Enhancer Primary T helper memory cells from peripheral blood 1 blood
12 chr1:161409400-161410200 Bivalent/Poised TSS Stomach Smooth Muscle stomach
13 chr1:161409400-161410400 Flanking Bivalent TSS/Enh Rectal Mucosa Donor 29 rectum
14 chr1:161409400-161410600 Bivalent/Poised TSS ES-I3 Cell Line embryonic stem cell
15 chr1:161409400-161410600 Active TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
16 chr1:161409400-161410600 Flanking Active TSS HMEC breast
17 chr1:161409400-161410600 Active TSS HSMM muscle
18 chr1:161409600-161410200 Flanking Active TSS Primary hematopoietic stem cells short term culture blood
19 chr1:161409600-161410200 Bivalent Enhancer Fetal Thymus thymus
20 chr1:161409600-161410200 Flanking Active TSS Lung lung
21 chr1:161409600-161410600 Bivalent/Poised TSS HUES6 Cell Line embryonic stem cell
22 chr1:161409600-161410600 Flanking Bivalent TSS/Enh Primary neutrophils fromperipheralblood blood
23 chr1:161409600-161410600 Active TSS Muscle Satellite Cultured Cells --
24 chr1:161409600-161410600 Bivalent/Poised TSS Brain Inferior Temporal Lobe brain
25 chr1:161409600-161410600 Bivalent/Poised TSS Brain Dorsolateral Prefrontal Cortex brain
26 chr1:161409600-161410600 Bivalent/Poised TSS Rectal Smooth Muscle rectum
27 chr1:161409600-161410600 Active TSS HSMMtube muscle
28 chr1:161409600-161410800 Active TSS H9 Cell Line embryonic stem cell
29 chr1:161409600-161410800 Bivalent/Poised TSS Psoas Muscle Psoas
30 chr1:161409800-161410200 Enhancers Primary T killer naive cells fromperipheralblood blood
31 chr1:161409800-161410200 Active TSS Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
32 chr1:161409800-161410200 Bivalent/Poised TSS Esophagus oesophagus
33 chr1:161409800-161410200 Active TSS Right Atrium heart
34 chr1:161409800-161410600 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
35 chr1:161409800-161410600 Bivalent/Poised TSS iPS-18 Cell Line embryonic stem cell
36 chr1:161409800-161410600 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
37 chr1:161409800-161410600 Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
38 chr1:161409800-161410600 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
39 chr1:161409800-161410600 Active TSS Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
40 chr1:161409800-161410600 Active TSS Primary T helper naive cells fromperipheralblood blood
41 chr1:161409800-161410600 Active TSS Brain Angular Gyrus brain
42 chr1:161409800-161410600 Bivalent/Poised TSS Brain Cingulate Gyrus brain
43 chr1:161409800-161410600 Bivalent/Poised TSS Brain Hippocampus Middle brain
44 chr1:161409800-161410600 Active TSS Brain Substantia Nigra brain
45 chr1:161409800-161410600 Bivalent/Poised TSS Colon Smooth Muscle Colon
46 chr1:161409800-161410600 Bivalent/Poised TSS Duodenum Smooth Muscle Duodenum
47 chr1:161409800-161410600 Bivalent/Poised TSS Fetal Intestine Large intestine
48 chr1:161409800-161410600 Flanking Active TSS Pancreas Pancrea
49 chr1:161409800-161410600 Bivalent/Poised TSS Thymus Thymus
50 chr1:161409800-161410600 Active TSS A549 lung

Quick Search:


  
Input of quick search could be:

what's new

Quick links