Variant report

Variant	rs561632177
Chromosome Location	chr2:205410334-205410335
allele	-/GCCAGGGCCAGGGCCAGGGCCAGGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	POLR2A	chr2:205409696-205410519	HUVEC	blood vessel:	n/a	n/a
2	POLR2A	chr2:205410151-205410417	A549	lung:	n/a	n/a
3	RAD21	chr2:205409866-205410416	H1-hESC	embryonic stem cell:	n/a	chr2:205409867-205409881
4	NR2F2	chr2:205409361-205410782	MCF-7	breast:	n/a	chr2:205409639-205409654
5	MAX	chr2:205409548-205411099	H1-hESC	embryonic stem cell:	n/a	n/a
6	RCOR1	chr2:205409638-205410339	Hela-S3	cervix:	n/a	n/a
7	E2F6	chr2:205409443-205411309	K562	blood:	n/a	chr2:205410532-205410544 chr2:205410300-205410310 chr2:205410216-205410226 chr2:205410041-205410052
8	E2F6	chr2:205409740-205410362	A549	lung:	n/a	chr2:205410300-205410310 chr2:205410216-205410226 chr2:205410041-205410052
9	TFAP2C	chr2:205409334-205410758	Hela-S3	cervix:	n/a	chr2:205410583-205410598 chr2:205409789-205409804
10	POLR2A	chr2:205409783-205410618	H1-hESC	embryonic stem cell:	n/a	n/a
11	UBTF	chr2:205409609-205410664	K562	blood:	n/a	n/a
12	MAX	chr2:205409547-205410438	HCT-116	colon:	n/a	n/a
13	POLR2A	chr2:205410007-205410424	PFSK-1	brain:	n/a	n/a
14	CEBPB	chr2:205409443-205410423	Hela-S3	cervix:	n/a	n/a
15	MAX	chr2:205409598-205410363	K562	blood:	n/a	n/a
16	POLR2A	chr2:205409614-205411156	MCF10A-Er-Src	breast:	n/a	n/a
17	MAX	chr2:205409496-205410390	MCF-7	breast:	n/a	n/a
18	MAX	chr2:205409428-205411143	MCF-7	breast:	n/a	n/a
19	USF1	chr2:205409838-205410382	ECC-1	luminal epithelium:	n/a	n/a
20	MAX	chr2:205409580-205410938	K562	blood:	n/a	n/a
21	POLR2A	chr2:205409807-205410561	HUVEC	blood vessel:	n/a	n/a
22	POLR2A	chr2:205409657-205410591	ECC-1	luminal epithelium:	n/a	n/a
23	CTBP2	chr2:205409740-205411060	H1-hESC	embryonic stem cell:	n/a	n/a
24	POLR2A	chr2:205409741-205410582	Gliobla	brain:	n/a	n/a
25	YY1	chr2:205409833-205410390	ECC-1	luminal epithelium:	n/a	chr2:205410207-205410221
26	JUND	chr2:205409910-205410421	A549	lung:	n/a	n/a
27	MAX	chr2:205409646-205410447	SK-N-SH	brain:	n/a	n/a
28	POLR2A	chr2:205409778-205410407	A549	lung:	n/a	n/a
29	YY1	chr2:205409987-205410466	HepG2	liver:	n/a	chr2:205410207-205410221
30	HMGN3	chr2:205409930-205410979	K562	blood:	n/a	n/a
31	MYC	chr2:205409803-205410982	MCF10A-Er-Src	breast:	n/a	n/a
32	POLR2A	chr2:205410116-205410621	ProgFib	skin:	n/a	n/a
33	HA-E2F1	chr2:205409291-205411382	MCF-7	breast:	n/a	chr2:205410532-205410544 chr2:205410300-205410310 chr2:205410216-205410226
34	EGR1	chr2:205409915-205410373	H1-hESC	embryonic stem cell:	n/a	chr2:205410214-205410223
35	TCF12	chr2:205409488-205410442	A549	lung:	n/a	chr2:205409606-205409615
36	RAD21	chr2:205410018-205410362	H1-hESC	embryonic stem cell:	n/a	n/a
37	EP300	chr2:205409670-205410607	ECC-1	luminal epithelium:	n/a	chr2:205410216-205410225
38	ZNF263	chr2:205409673-205411588	HEK293-T-REx	kidney:	n/a	n/a
39	MAX	chr2:205409470-205411022	H1-hESC	embryonic stem cell:	n/a	n/a
40	TCF12	chr2:205409530-205411076	ECC-1	luminal epithelium:	n/a	chr2:205409606-205409615
41	MAZ	chr2:205409773-205410501	K562	blood:	n/a	n/a
42	POLR2A	chr2:205409702-205411060	MCF-7	breast:	n/a	n/a
43	POLR2A	chr2:205410017-205410431	A549	lung:	n/a	n/a
44	POLR2A	chr2:205409629-205410501	IMR90	lung:	n/a	n/a
45	TAF1	chr2:205409652-205410705	ECC-1	luminal epithelium:	n/a	n/a
46	TFAP2A	chr2:205409247-205410554	Hela-S3	cervix:	n/a	chr2:205409792-205409804 chr2:205410104-205410116 chr2:205409792-205409804 chr2:205410304-205410319 chr2:205409789-205409804 chr2:205409792-205409804 chr2:205409792-205409804
47	POLR2A	chr2:205409818-205410495	A549	lung:	n/a	n/a
48	POLR2A	chr2:205409597-205410532	MCF-7	breast:	n/a	n/a
49	POLR2A	chr2:205409568-205411263	ECC-1	luminal epithelium:	n/a	n/a
50	CCNT2	chr2:205410018-205410398	K562	blood:	n/a	n/a

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr2:205406485..205408306-chr2:205408736..205410499,2	K562	blood:
2	chr2:205409966..205412745-chr6:70504641..70507004,2	MCF-7	breast:

Variant related genes	Relation type
PARD3B	TF binding region
ENSG00000168216	Chromatin interaction

Extended variants
information (count: 4 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:4 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv964353	chr2:205303005-205473935	Enhancers Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Bivalent Enhancer Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
2	nsv998485	chr2:205407813-206184006	Enhancers Weak transcription Strong transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
3	nsv536122	chr2:205407813-206184006	Enhancers Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
4	esv3422948	chr2:205409232-205412080	Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Enhancers Bivalent Enhancer Weak transcription Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:120 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr2:205409200-205410800	Active TSS	Skeletal Muscle Female	skeletal muscle
2	chr2:205409200-205411000	Active TSS	Brain Substantia Nigra	brain
3	chr2:205409200-205411400	Active TSS	Colonic Mucosa	Colon
4	chr2:205409400-205410800	Active TSS	Brain Cingulate Gyrus	brain
5	chr2:205409400-205410800	Active TSS	NH-A	brain
6	chr2:205409400-205411000	Active TSS	Brain Hippocampus Middle	brain
7	chr2:205409400-205411000	Active TSS	Rectal Mucosa Donor 29	rectum
8	chr2:205409400-205411200	Bivalent/Poised TSS	ES-I3 Cell Line	embryonic stem cell
9	chr2:205409400-205411200	Bivalent/Poised TSS	ES-WA7 Cell Line	embryonic stem cell
10	chr2:205409400-205411800	Active TSS	Ovary	ovary
11	chr2:205409400-205412200	Active TSS	Right Atrium	heart
12	chr2:205409600-205410800	Active TSS	iPS DF 6.9 Cell Line	embryonic stem cell
13	chr2:205409600-205410800	Active TSS	Brain Anterior Caudate	brain
14	chr2:205409600-205410800	Active TSS	Lung	lung
15	chr2:205409600-205410800	Active TSS	Right Ventricle	heart
16	chr2:205409600-205410800	Active TSS	Sigmoid Colon	Sigmoid Colon
17	chr2:205409600-205411000	Active TSS	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
18	chr2:205409600-205411000	Active TSS	Left Ventricle	heart
19	chr2:205409600-205411000	Active TSS	Psoas Muscle	Psoas
20	chr2:205409600-205411000	Bivalent/Poised TSS	Thymus	Thymus
21	chr2:205409600-205411000	Active TSS	A549	lung
22	chr2:205409600-205411200	Active TSS	Brain Dorsolateral Prefrontal Cortex	brain
23	chr2:205409600-205411200	Active TSS	Gastric	stomach
24	chr2:205409600-205411400	Bivalent/Poised TSS	HUES64 Cell Line	embryonic stem cell
25	chr2:205409600-205411400	Active TSS	Brain Inferior Temporal Lobe	brain
26	chr2:205409600-205411400	Active TSS	Fetal Intestine Large	intestine
27	chr2:205409600-205411400	Active TSS	Small Intestine	intestine
28	chr2:205409600-205411800	Active TSS	Pancreatic Islets	Pancreatic Islet
29	chr2:205409600-205412000	Active TSS	Aorta	Aorta
30	chr2:205409600-205412400	Active TSS	Fetal Kidney	kidney
31	chr2:205409800-205410600	Active TSS	Spleen	Spleen
32	chr2:205409800-205410800	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
33	chr2:205409800-205410800	Bivalent/Poised TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
34	chr2:205409800-205410800	Bivalent/Poised TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
35	chr2:205409800-205410800	Bivalent/Poised TSS	HUES48 Cell Line	embryonic stem cell
36	chr2:205409800-205410800	Active TSS	ES-UCSF4 Cell Line	embryonic stem cell
37	chr2:205409800-205410800	Flanking Active TSS	Primary hematopoietic stem cells short term culture	blood
38	chr2:205409800-205410800	Bivalent/Poised TSS	Foreskin Keratinocyte Primary Cells skin02	Skin
39	chr2:205409800-205410800	Active TSS	Fetal Muscle Leg	muscle
40	chr2:205409800-205410800	Active TSS	Fetal Stomach	stomach
41	chr2:205409800-205410800	Active TSS	K562	blood
42	chr2:205409800-205411000	Bivalent/Poised TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
43	chr2:205409800-205411000	Bivalent/Poised TSS	iPS-15b Cell Line	embryonic stem cell
44	chr2:205409800-205411000	Bivalent/Poised TSS	iPS-20b Cell Line	embryonic stem cell
45	chr2:205409800-205411000	Active TSS	Breast Myoepithelial Primary Cells	Breast
46	chr2:205409800-205411000	Bivalent/Poised TSS	Primary T helper cells PMA-I stimulated	--
47	chr2:205409800-205411200	Active TSS	H9 Cell Line	embryonic stem cell
48	chr2:205409800-205411200	Active TSS	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
49	chr2:205409800-205411200	Active TSS	Colon Smooth Muscle	Colon
50	chr2:205409800-205411200	Active TSS	Duodenum Mucosa	Duodenum

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links