Variant report

Variant rs562448805
Chromosome Location chr6:4775660-4775661
allele -/GAGCGAGGGCCAGCCCTCGCTGTTCT
Outlinks Ensembl   UCSC
Chromatin state (count:121 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr6:4772600-4776200 Active TSS ES-WA7 Cell Line embryonic stem cell
2 chr6:4772800-4777200 Active TSS H1 Cell Line embryonic stem cell
3 chr6:4772800-4777800 Active TSS ES-I3 Cell Line embryonic stem cell
4 chr6:4773000-4777400 Active TSS HUES48 Cell Line embryonic stem cell
5 chr6:4773000-4777600 Active TSS ES-UCSF4 Cell Line embryonic stem cell
6 chr6:4773200-4777400 Active TSS H9 Cell Line embryonic stem cell
7 chr6:4773200-4777400 Active TSS iPS-18 Cell Line embryonic stem cell
8 chr6:4773200-4777400 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
9 chr6:4773200-4777600 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
10 chr6:4773200-4778200 Active TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
11 chr6:4774200-4778000 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
12 chr6:4774600-4775800 Bivalent/Poised TSS iPS-20b Cell Line embryonic stem cell
13 chr6:4774600-4777400 Active TSS iPS-15b Cell Line embryonic stem cell
14 chr6:4774800-4775800 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
15 chr6:4774800-4775800 Flanking Active TSS Primary B cells from cord blood blood
16 chr6:4774800-4775800 Flanking Active TSS Primary hematopoietic stem cells blood
17 chr6:4774800-4775800 Flanking Active TSS Primary T helper cells fromperipheralblood blood
18 chr6:4774800-4775800 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Female --
19 chr6:4774800-4777800 Active TSS Brain Inferior Temporal Lobe brain
20 chr6:4774800-4778000 Active TSS Stomach Smooth Muscle stomach
21 chr6:4775000-4775800 Flanking Bivalent TSS/Enh Primary neutrophils fromperipheralblood blood
22 chr6:4775000-4775800 Flanking Active TSS Primary B cells from peripheral blood blood
23 chr6:4775000-4775800 Flanking Active TSS Primary T cells fromperipheralblood blood
24 chr6:4775000-4775800 Flanking Active TSS Primary T helper naive cells fromperipheralblood blood
25 chr6:4775000-4775800 Flanking Active TSS Primary T helper cells PMA-I stimulated --
26 chr6:4775000-4775800 Flanking Active TSS Primary T helper 17 cells PMA-I stimulated --
27 chr6:4775000-4775800 Flanking Active TSS Primary Natural Killer cells fromperipheralblood blood
28 chr6:4775000-4775800 Flanking Bivalent TSS/Enh Foreskin Fibroblast Primary Cells skin01 Skin
29 chr6:4775000-4775800 Flanking Active TSS Foreskin Keratinocyte Primary Cells skin03 Skin
30 chr6:4775000-4775800 Flanking Active TSS Adipose Nuclei Adipose
31 chr6:4775000-4775800 Flanking Active TSS Liver Liver
32 chr6:4775000-4775800 Flanking Active TSS Duodenum Mucosa Duodenum
33 chr6:4775000-4775800 Flanking Bivalent TSS/Enh Fetal Adrenal Gland Adrenal Gland
34 chr6:4775000-4775800 Flanking Active TSS Pancreas Pancrea
35 chr6:4775000-4775800 Flanking Bivalent TSS/Enh HepG2 liver
36 chr6:4775000-4777000 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
37 chr6:4775000-4777000 Active TSS Placenta Amnion Placenta Amnion
38 chr6:4775000-4777600 Active TSS Brain Substantia Nigra brain
39 chr6:4775000-4777800 Active TSS Brain Angular Gyrus brain
40 chr6:4775000-4777800 Active TSS Brain Dorsolateral Prefrontal Cortex brain
41 chr6:4775000-4777800 Active TSS Colon Smooth Muscle Colon
42 chr6:4775000-4777800 Active TSS Esophagus oesophagus
43 chr6:4775000-4777800 Active TSS Pancreatic Islets Pancreatic Islet
44 chr6:4775000-4777800 Active TSS Gastric stomach
45 chr6:4775000-4777800 Active TSS Rectal Mucosa Donor 31 rectum
46 chr6:4775000-4777800 Active TSS Rectal Smooth Muscle rectum
47 chr6:4775000-4778000 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
48 chr6:4775000-4778000 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
49 chr6:4775000-4778000 Active TSS Ovary ovary
50 chr6:4775000-4778400 Active TSS Brain Cingulate Gyrus brain

Quick Search:


  
Input of quick search could be:

what's new

Quick links