Variant report

Variant	rs562749185
Chromosome Location	chr4:132896167-132896168
allele	-/ACAAGCCCAAGTACTGGTGTGGACA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 27 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:27 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv533069	chr4:132266740-132906467	Enhancers Weak transcription Active TSS ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
2	nsv427695	chr4:132369789-132930726	Weak transcription Enhancers Active TSS ZNF genes & repeats Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
3	esv19423	chr4:132558697-132899638	Active TSS ZNF genes & repeats Weak transcription Enhancers Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
4	esv1806509	chr4:132569215-132903485	Enhancers Active TSS Bivalent Enhancer ZNF genes & repeats Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
5	esv1811989	chr4:132574098-132902027	Flanking Active TSS Active TSS ZNF genes & repeats Enhancers Weak transcription Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island lncRNA	7 gene(s)	inside rSNPs	diseases
6	esv1807680	chr4:132577148-132902227	Enhancers ZNF genes & repeats Active TSS Weak transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island lncRNA	7 gene(s)	inside rSNPs	diseases
7	esv1812383	chr4:132585798-132903485	Enhancers Active TSS ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island lncRNA	7 gene(s)	inside rSNPs	diseases
8	esv1804660	chr4:132592512-132902227	Active TSS Enhancers ZNF genes & repeats Flanking Active TSS Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island lncRNA	7 gene(s)	inside rSNPs	diseases
9	esv1811099	chr4:132592712-132902027	ZNF genes & repeats Active TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island lncRNA	7 gene(s)	inside rSNPs	diseases
10	nsv428450	chr4:132597437-132930726	Active TSS Enhancers ZNF genes & repeats Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
11	esv1804362	chr4:132644678-132930726	Active TSS ZNF genes & repeats Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
12	esv1804912	chr4:132644678-132930726	Active TSS Weak transcription ZNF genes & repeats Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
13	esv1811738	chr4:132699078-132903485	Active TSS Enhancers ZNF genes & repeats Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island lncRNA	2 gene(s)	inside rSNPs	diseases
14	esv1812429	chr4:132757207-132930726	Active TSS Enhancers Weak transcription ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
15	nsv830069	chr4:132765958-132942344	Weak transcription Enhancers Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
16	nsv879989	chr4:132773067-133001527	Active TSS Enhancers Weak transcription ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
17	nsv879990	chr4:132783846-133045796	Weak transcription Enhancers Transcr. at gene 5' and 3' Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
18	nsv879991	chr4:132799356-132919103	Active TSS Enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Weak transcription Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
19	esv19857	chr4:132828045-132901888	Active TSS Enhancers ZNF genes & repeats Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Weak transcription Flanking Bivalent TSS/Enh	TF binding region CpG island lncRNA	1 gene(s)	inside rSNPs	diseases
20	nsv879992	chr4:132880203-132948418	Enhancers Active TSS Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
21	nsv879993	chr4:132880203-132961058	Enhancers Active TSS ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
22	nsv879994	chr4:132880203-132976889	Active TSS Enhancers Bivalent Enhancer Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
23	nsv879995	chr4:132880203-133001527	Weak transcription Enhancers Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
24	nsv879996	chr4:132880203-133005854	Enhancers Active TSS ZNF genes & repeats Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
25	nsv879997	chr4:132880203-133045796	Active TSS Flanking Active TSS Enhancers Weak transcription ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
26	nsv967797	chr4:132892272-132902984	Active TSS ZNF genes & repeats Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Bivalent Enhancer	TF binding region CpG island lncRNA	1 gene(s)	inside rSNPs	diseases
27	esv1002400	chr4:132895998-132900083	Active TSS ZNF genes & repeats Enhancers Bivalent/Poised TSS Flanking Active TSS Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island lncRNA	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:38 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr4:132895400-132897200	Active TSS	Pancreatic Islets	Pancreatic Islet
2	chr4:132895800-132896400	Active TSS	Foreskin Fibroblast Primary Cells skin01	Skin
3	chr4:132895800-132897800	Active TSS	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
4	chr4:132896000-132896200	Enhancers	iPS-15b Cell Line	embryonic stem cell
5	chr4:132896000-132896200	Flanking Active TSS	Placenta	Placenta
6	chr4:132896000-132896200	Flanking Active TSS	HUVEC	blood vessel
7	chr4:132896000-132896400	Flanking Active TSS	Primary hematopoietic stem cells short term culture	blood
8	chr4:132896000-132896400	Active TSS	Fetal Intestine Large	intestine
9	chr4:132896000-132896600	Active TSS	Fetal Adrenal Gland	Adrenal Gland
10	chr4:132896000-132896600	Active TSS	Fetal Intestine Small	intestine
11	chr4:132896000-132896800	Active TSS	Duodenum Mucosa	Duodenum
12	chr4:132896000-132896800	Active TSS	NHEK	skin
13	chr4:132896000-132897000	Active TSS	Primary B cells from cord blood	blood
14	chr4:132896000-132897000	Active TSS	NHDF-Ad	bronchial
15	chr4:132896000-132897200	Active TSS	Ganglion Eminence derived primary cultured neurospheres	brain
16	chr4:132896000-132897200	Active TSS	Foreskin Keratinocyte Primary Cells skin03	Skin
17	chr4:132896000-132897400	Active TSS	Primary hematopoietic stem cells G-CSF-mobilized Female	--
18	chr4:132896000-132897400	Active TSS	Foreskin Melanocyte Primary Cells skin03	Skin
19	chr4:132896000-132897400	Active TSS	Duodenum Smooth Muscle	Duodenum
20	chr4:132896000-132897400	Active TSS	Fetal Muscle Trunk	muscle
21	chr4:132896000-132897400	Active TSS	Thymus	Thymus
22	chr4:132896000-132897400	Active TSS	GM12878-XiMat	blood
23	chr4:132896000-132897600	Active TSS	IMR90 fetal lung fibroblasts Cell Line	lung
24	chr4:132896000-132897600	Active TSS	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
25	chr4:132896000-132897600	Active TSS	Primary hematopoietic stem cells	blood
26	chr4:132896000-132897600	Active TSS	Primary T killer naive cells fromperipheralblood	blood
27	chr4:132896000-132897600	Active TSS	Esophagus	oesophagus
28	chr4:132896000-132897600	Active TSS	Fetal Stomach	stomach
29	chr4:132896000-132897800	Active TSS	HUES6 Cell Line	embryonic stem cell
30	chr4:132896000-132897800	Active TSS	Foreskin Melanocyte Primary Cells skin01	Skin
31	chr4:132896000-132897800	ZNF genes & repeats	Fetal Thymus	thymus
32	chr4:132896000-132897800	Active TSS	Ovary	ovary
33	chr4:132896000-132897800	Active TSS	Stomach Smooth Muscle	stomach
34	chr4:132896000-132897800	Active TSS	Osteobl	bone
35	chr4:132896000-132898000	Active TSS	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
36	chr4:132896000-132898000	Active TSS	Rectal Mucosa Donor 31	rectum
37	chr4:132896000-132898000	Active TSS	HSMM	muscle
38	chr4:132896000-132898000	Active TSS	HSMMtube	muscle

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links