Variant report

Variant	rs56699114
Chromosome Location	chr5:42579236-42579237
allele	-/GATAGATGATAGATAGATATAGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr5:42577335..42580605-chr5:42585374..42588343,3	K562	blood:
2	chr5:42518684..42521037-chr5:42577892..42580696,2	K562	blood:

Extended variants
information (count: 8 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:8 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv933208	chr5:41879946-42876624	Active TSS Enhancers Weak transcription Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	112 gene(s)	inside rSNPs	diseases
2	nsv492147	chr5:41902086-42896162	Enhancers Flanking Active TSS Active TSS Genic enhancers Weak transcription Strong transcription Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	113 gene(s)	inside rSNPs	diseases
3	nsv1020464	chr5:42488628-42699394	Active TSS Enhancers Weak transcription Flanking Active TSS Genic enhancers Strong transcription ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
4	nsv1018751	chr5:42491883-42697923	Weak transcription Flanking Active TSS Enhancers Strong transcription Active TSS ZNF genes & repeats Genic enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
5	esv2415807	chr5:42579003-42579449	Enhancers Weak transcription Strong transcription	Chromatin interactive region	n/a	inside rSNPs	diseases
6	esv3419545	chr5:42579152-42579315	Weak transcription Enhancers	Chromatin interactive region	n/a	inside rSNPs	diseases
7	esv1697615	chr5:42579202-42579246	Weak transcription Enhancers	Chromatin interactive region	n/a	inside rSNPs	diseases
8	nsv318824	chr5:42579231-42579238	Weak transcription Enhancers	Chromatin interactive region	n/a	inside rSNPs	diseases

No data

Chromatin state (count:20 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:42568000-42579400	Weak transcription	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
2	chr5:42568000-42581400	Weak transcription	Fetal Muscle Trunk	muscle
3	chr5:42568000-42582200	Weak transcription	Fetal Intestine Small	intestine
4	chr5:42568400-42581800	Weak transcription	Fetal Stomach	stomach
5	chr5:42568400-42582800	Weak transcription	Ovary	ovary
6	chr5:42571800-42579400	Weak transcription	Breast Myoepithelial Primary Cells	Breast
7	chr5:42571800-42581200	Weak transcription	Adipose Nuclei	Adipose
8	chr5:42571800-42583400	Weak transcription	Stomach Smooth Muscle	stomach
9	chr5:42572200-42587800	Weak transcription	Left Ventricle	heart
10	chr5:42572400-42582800	Weak transcription	Right Ventricle	heart
11	chr5:42572800-42579400	Weak transcription	Foreskin Fibroblast Primary Cells skin01	Skin
12	chr5:42572800-42583000	Weak transcription	Fetal Muscle Leg	muscle
13	chr5:42573000-42579400	Weak transcription	Skeletal Muscle Male	skeletal muscle
14	chr5:42573000-42581800	Weak transcription	Foreskin Fibroblast Primary Cells skin02	Skin
15	chr5:42573000-42582000	Weak transcription	Fetal Lung	lung
16	chr5:42573600-42586600	Weak transcription	Psoas Muscle	Psoas
17	chr5:42574600-42579400	Weak transcription	Skeletal Muscle Female	skeletal muscle
18	chr5:42576200-42581200	Enhancers	Liver	Liver
19	chr5:42578600-42580000	Enhancers	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
20	chr5:42579000-42580000	Enhancers	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links