Variant report

Variant	rs567837832
Chromosome Location	chr12:22124889-22124890
allele	-/ATACTCACTTGTACAAAACAAAAAG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 6 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:6 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv557741	chr12:21578559-22169854	Strong transcription Enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	50 gene(s)	inside rSNPs	diseases
2	nsv1051073	chr12:21910875-22271209	Flanking Bivalent TSS/Enh Weak transcription Active TSS Enhancers Genic enhancers Flanking Active TSS ZNF genes & repeats Strong transcription Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
3	nsv470275	chr12:21938544-22126314	Weak transcription Enhancers Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Strong transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
4	nsv639	chr12:22110979-22153478	Enhancers Flanking Active TSS Weak transcription Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
5	esv3342564	chr12:22123778-22128844	Enhancers Flanking Active TSS Weak transcription	n/a	n/a	inside rSNPs	diseases
6	esv3419963	chr12:22123788-22128847	Enhancers Weak transcription Flanking Active TSS	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:9 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr12:22124000-22125000	Enhancers	iPS-15b Cell Line	embryonic stem cell
2	chr12:22124000-22125000	Enhancers	ES-UCSF4 Cell Line	embryonic stem cell
3	chr12:22124000-22125400	Enhancers	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
4	chr12:22124200-22125000	Enhancers	HUES48 Cell Line	embryonic stem cell
5	chr12:22124200-22125000	Enhancers	HUES64 Cell Line	embryonic stem cell
6	chr12:22124200-22125200	Enhancers	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
7	chr12:22124400-22126000	Enhancers	Foreskin Melanocyte Primary Cells skin03	Skin
8	chr12:22124600-22125800	Weak transcription	Fetal Kidney	kidney
9	chr12:22124800-22125000	Enhancers	HUES6 Cell Line	embryonic stem cell

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links