Variant report

Variant rs568065195
Chromosome Location chr8:103875614-103875615
allele -/GGGCTGCGGGACCCCGGCCCCTCA
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr8:103872400-103877200 Active TSS Breast Myoepithelial Primary Cells Breast
2 chr8:103872800-103878000 Active TSS H1 Cell Line embryonic stem cell
3 chr8:103873000-103876800 Active TSS Placenta Placenta
4 chr8:103873000-103877600 Active TSS GM12878-XiMat blood
5 chr8:103873000-103877800 Active TSS H9 Cell Line embryonic stem cell
6 chr8:103873200-103877400 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
7 chr8:103873200-103877400 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
8 chr8:103873200-103877400 Active TSS HUES48 Cell Line embryonic stem cell
9 chr8:103873400-103877200 Active TSS H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
10 chr8:103873400-103877200 Active TSS Pancreas Pancrea
11 chr8:103873400-103877400 Active TSS HUES64 Cell Line embryonic stem cell
12 chr8:103873400-103877400 Active TSS iPS-15b Cell Line embryonic stem cell
13 chr8:103873400-103877600 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
14 chr8:103873600-103876200 Active TSS iPS DF 19.11 Cell Line embryonic stem cell
15 chr8:103873600-103877800 Active TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
16 chr8:103873800-103877000 Active TSS HMEC breast
17 chr8:103873800-103877400 Active TSS Brain Dorsolateral Prefrontal Cortex brain
18 chr8:103873800-103877600 Active TSS HSMM muscle
19 chr8:103873800-103877800 Active TSS Pancreatic Islets Pancreatic Islet
20 chr8:103874000-103877600 Active TSS ES-UCSF4 Cell Line embryonic stem cell
21 chr8:103874200-103876800 Active TSS Rectal Mucosa Donor 29 rectum
22 chr8:103874200-103877400 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
23 chr8:103874200-103877400 Active TSS Right Ventricle heart
24 chr8:103874200-103877400 Active TSS NHDF-Ad bronchial
25 chr8:103874200-103877800 Active TSS ES-WA7 Cell Line embryonic stem cell
26 chr8:103874200-103877800 Active TSS Foreskin Fibroblast Primary Cells skin02 Skin
27 chr8:103874400-103876800 Active TSS Primary T cells fromperipheralblood blood
28 chr8:103874400-103877000 Active TSS HSMMtube muscle
29 chr8:103874400-103877200 Active TSS Fetal Kidney kidney
30 chr8:103874400-103877400 Active TSS IMR90 fetal lung fibroblasts Cell Line lung
31 chr8:103874400-103877400 Active TSS Fetal Intestine Large intestine
32 chr8:103874600-103876800 Active TSS Foreskin Melanocyte Primary Cells skin01 Skin
33 chr8:103874600-103877000 Active TSS Stomach Smooth Muscle stomach
34 chr8:103874600-103877200 Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
35 chr8:103874600-103877200 Active TSS Bone Marrow Derived Cultured Mesenchymal Stem Cells Bone marrow
36 chr8:103874600-103877200 Active TSS Muscle Satellite Cultured Cells --
37 chr8:103874600-103877200 Active TSS Fetal Intestine Small intestine
38 chr8:103874600-103877400 Active TSS Psoas Muscle Psoas
39 chr8:103874600-103877600 Active TSS Foreskin Keratinocyte Primary Cells skin03 Skin
40 chr8:103874600-103877600 Active TSS Fetal Muscle Trunk muscle
41 chr8:103874800-103877000 Transcr. at gene 5' and 3' Primary T helper 17 cells PMA-I stimulated --
42 chr8:103874800-103877000 Active TSS Fetal Muscle Leg muscle
43 chr8:103874800-103877000 Active TSS Gastric stomach
44 chr8:103874800-103877000 Active TSS NHEK skin
45 chr8:103874800-103877200 Active TSS H1 Derived Mesenchymal Stem Cells ES cell derived
46 chr8:103874800-103877200 Active TSS Esophagus oesophagus
47 chr8:103874800-103877200 Active TSS Ovary ovary
48 chr8:103874800-103877200 Active TSS Placenta Amnion Placenta Amnion
49 chr8:103874800-103877200 Active TSS Small Intestine intestine
50 chr8:103874800-103877200 Active TSS Thymus Thymus

Quick Search:


  
Input of quick search could be:

what's new

Quick links