Variant report

Variant	rs569686106
Chromosome Location	chr18:7115656-7115657
allele	-/AAAATCGTTTCTTAAAAAAAAAA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 26 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:26 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv916883	chr18:6299209-7244642	Weak transcription Strong transcription Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Genic enhancers Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	42 gene(s)	inside rSNPs	diseases
2	nsv1063762	chr18:6542534-7382339	ZNF genes & repeats Weak transcription Flanking Active TSS Enhancers Strong transcription Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
3	nsv543630	chr18:6542534-7382339	Strong transcription Enhancers ZNF genes & repeats Flanking Active TSS Active TSS Bivalent Enhancer Weak transcription Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
4	nsv1064175	chr18:6740267-7384528	Weak transcription Transcr. at gene 5' and 3' Flanking Active TSS Enhancers Genic enhancers Strong transcription Bivalent/Poised TSS Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	30 gene(s)	inside rSNPs	diseases
5	nsv1059956	chr18:6786579-7382339	Weak transcription Bivalent Enhancer Enhancers Active TSS Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	30 gene(s)	inside rSNPs	diseases
6	nsv543632	chr18:6786579-7382339	Strong transcription Weak transcription Active TSS Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	30 gene(s)	inside rSNPs	diseases
7	nsv1059970	chr18:6846443-7281397	Weak transcription Bivalent/Poised TSS Enhancers Strong transcription Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
8	nsv543633	chr18:6846443-7281397	Weak transcription Bivalent Enhancer Enhancers Active TSS Strong transcription ZNF genes & repeats Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
9	nsv1064956	chr18:6846503-7281337	Enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Strong transcription Bivalent/Poised TSS Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
10	nsv543634	chr18:6846503-7281337	Enhancers Weak transcription Genic enhancers Strong transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	29 gene(s)	inside rSNPs	diseases
11	esv3584943	chr18:6873354-7434329	Weak transcription Enhancers Flanking Active TSS Bivalent/Poised TSS Strong transcription Flanking Bivalent TSS/Enh Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	30 gene(s)	inside rSNPs	diseases
12	nsv817574	chr18:6894969-7577149	Enhancers Weak transcription Active TSS Genic enhancers Bivalent Enhancer Strong transcription Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	31 gene(s)	inside rSNPs	diseases
13	nsv868851	chr18:6947043-7470214	Enhancers Weak transcription ZNF genes & repeats Active TSS Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
14	nsv491761	chr18:6973010-7595578	Enhancers Flanking Active TSS Weak transcription Strong transcription Active TSS Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
15	nsv1056521	chr18:7010334-7169550	Active TSS Strong transcription ZNF genes & repeats Enhancers Weak transcription Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
16	nsv909339	chr18:7076836-7207967	Enhancers Genic enhancers Weak transcription Flanking Bivalent TSS/Enh Active TSS Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Strong transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
17	nsv909340	chr18:7076836-7329035	Weak transcription Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Bivalent Enhancer Active TSS Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
18	nsv909341	chr18:7076836-7369057	Enhancers Active TSS Flanking Bivalent TSS/Enh Strong transcription Weak transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
19	nsv909342	chr18:7076836-7475949	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Active TSS Bivalent/Poised TSS ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
20	nsv909343	chr18:7076836-7578782	Enhancers Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Active TSS Weak transcription Bivalent/Poised TSS Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
21	nsv909344	chr18:7080135-7523336	Enhancers Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
22	nsv909345	chr18:7080135-7578782	Active TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
23	nsv1063836	chr18:7086752-7562051	Flanking Active TSS Enhancers Weak transcription Bivalent/Poised TSS ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
24	nsv543635	chr18:7086752-7562051	Enhancers Weak transcription Genic enhancers Flanking Active TSS Bivalent Enhancer Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
25	esv2656232	chr18:7111033-7658679	Enhancers Flanking Bivalent TSS/Enh Weak transcription Flanking Active TSS Active TSS Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
26	nsv532282	chr18:7115075-7608218	Enhancers Weak transcription Bivalent/Poised TSS Active TSS Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:15 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr18:7105000-7116000	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
2	chr18:7111600-7116000	Weak transcription	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
3	chr18:7111800-7116000	Weak transcription	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
4	chr18:7112400-7116000	Weak transcription	HMEC	breast
5	chr18:7113200-7116200	Weak transcription	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
6	chr18:7113400-7115800	Weak transcription	Cortex derived primary cultured neurospheres	brain
7	chr18:7113400-7116000	Weak transcription	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
8	chr18:7113400-7116000	Weak transcription	Breast Myoepithelial Primary Cells	Breast
9	chr18:7113600-7116000	Weak transcription	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
10	chr18:7113600-7116000	Weak transcription	HUES6 Cell Line	embryonic stem cell
11	chr18:7113600-7116000	Weak transcription	ES-UCSF4 Cell Line	embryonic stem cell
12	chr18:7113800-7115800	Weak transcription	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
13	chr18:7115400-7116000	Active TSS	H9 Derived Neuron Cultured Cells	ES cell derived
14	chr18:7115400-7118400	Active TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
15	chr18:7115600-7115800	Weak transcription	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links