Variant report

Variant	rs569702070
Chromosome Location	chr4:7799799-7799800
allele	-/ATTGCAACTCTATTGGCTGGCTCACGGC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	FOS	chr4:7799741-7800327	K562	blood:	n/a	n/a
2	SP1	chr4:7799702-7800268	A549	lung:	n/a	n/a
3	NFYB	chr4:7799600-7800399	K562	blood:	n/a	chr4:7799806-7799821
4	NFYB	chr4:7799553-7800582	Hela-S3	cervix:	n/a	chr4:7799806-7799821
5	SP1	chr4:7799628-7800332	GM12878	blood:	n/a	n/a
6	SP1	chr4:7799637-7800416	A549	lung:	n/a	n/a
7	SP1	chr4:7799784-7800345	H1-hESC	embryonic stem cell:	n/a	n/a
8	NFYA	chr4:7799443-7800428	Hela-S3	cervix:	n/a	n/a
9	SP1	chr4:7799577-7800400	K562	blood:	n/a	n/a
10	POLR2A	chr4:7799758-7800211	H1-hESC	embryonic stem cell:	n/a	n/a
11	NFYA	chr4:7799602-7800261	K562	blood:	n/a	n/a
12	SP1	chr4:7799712-7800270	GM12878	blood:	n/a	n/a
13	NFYB	chr4:7799622-7800463	GM12878	blood:	n/a	chr4:7799806-7799821
14	POLR2A	chr4:7799396-7801058	PANC-1	pancreas:	n/a	n/a

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr4:7799366..7802066-chr4:7938906..7941900,2	MCF-7	breast:

Variant related genes	Relation type
AFAP1	TF binding region
ENSG00000196526	Chromatin interaction
ENSG00000228919	Chromatin interaction

Extended variants
information (count: 11 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:11 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv878570	chr4:7534603-7836835	Bivalent Enhancer Flanking Active TSS Enhancers Weak transcription Strong transcription ZNF genes & repeats Genic enhancers Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	12 gene(s)	inside rSNPs	diseases
2	nsv491712	chr4:7582506-8155069	Enhancers Bivalent Enhancer Genic enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
3	nsv1007319	chr4:7705550-7832097	Strong transcription Flanking Active TSS Weak transcription Enhancers Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	8 gene(s)	inside rSNPs	diseases
4	nsv537018	chr4:7705550-7832097	Genic enhancers Strong transcription Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	8 gene(s)	inside rSNPs	diseases
5	nsv1006642	chr4:7786980-7811291	Strong transcription Weak transcription Genic enhancers Enhancers ZNF genes & repeats Flanking Active TSS Transcr. at gene 5' and 3' Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
6	esv34140	chr4:7787936-8172491	Enhancers Weak transcription Genic enhancers Flanking Active TSS Strong transcription Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	18 gene(s)	inside rSNPs	diseases
7	esv3512686	chr4:7799724-7800195	Strong transcription Weak transcription ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
8	esv2144252	chr4:7799729-7800170	Weak transcription Strong transcription ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
9	esv3512687	chr4:7799742-7800163	Strong transcription Weak transcription Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
10	esv3512688	chr4:7799742-7800163	ZNF genes & repeats Weak transcription Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
11	nsv293706	chr4:7799799-7799826	Strong transcription Weak transcription	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:108 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr4:7762000-7805800	Weak transcription	Stomach Mucosa	stomach
2	chr4:7770800-7828400	Weak transcription	ES-WA7 Cell Line	embryonic stem cell
3	chr4:7776400-7800000	Weak transcription	H1 Cell Line	embryonic stem cell
4	chr4:7776400-7806800	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
5	chr4:7780600-7800200	Weak transcription	Primary T cells effector/memory enriched fromperipheralblood	blood
6	chr4:7781000-7800000	Weak transcription	iPS-20b Cell Line	embryonic stem cell
7	chr4:7781400-7800400	Weak transcription	Brain Inferior Temporal Lobe	brain
8	chr4:7781400-7801000	Weak transcription	Brain Substantia Nigra	brain
9	chr4:7781400-7801200	Weak transcription	Brain Anterior Caudate	brain
10	chr4:7781600-7807400	Weak transcription	Brain Angular Gyrus	brain
11	chr4:7783800-7806200	Weak transcription	Primary T killer naive cells fromperipheralblood	blood
12	chr4:7784000-7801800	Weak transcription	Primary T killer memory cells from peripheral blood	blood
13	chr4:7784000-7821200	Weak transcription	Small Intestine	intestine
14	chr4:7784200-7800600	Weak transcription	Brain Hippocampus Middle	brain
15	chr4:7784200-7800600	Weak transcription	Esophagus	oesophagus
16	chr4:7784200-7802200	Weak transcription	Aorta	Aorta
17	chr4:7784200-7802800	Strong transcription	Fetal Muscle Trunk	muscle
18	chr4:7784800-7803400	Strong transcription	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
19	chr4:7785800-7803800	Weak transcription	Primary T helper memory cells from peripheral blood 2	blood
20	chr4:7786000-7800800	Weak transcription	iPS-15b Cell Line	embryonic stem cell
21	chr4:7787000-7829400	Weak transcription	Primary T regulatory cells fromperipheralblood	blood
22	chr4:7787400-7800200	Weak transcription	Primary T helper naive cells fromperipheralblood	blood
23	chr4:7789200-7806600	Weak transcription	Brain Dorsolateral Prefrontal Cortex	brain
24	chr4:7790800-7800800	Weak transcription	Primary T helper 17 cells PMA-I stimulated	--
25	chr4:7790800-7803600	Strong transcription	HSMM	muscle
26	chr4:7791000-7801400	Weak transcription	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
27	chr4:7791000-7806600	Weak transcription	Psoas Muscle	Psoas
28	chr4:7791000-7829400	Weak transcription	Primary monocytes fromperipheralblood	blood
29	chr4:7791200-7800800	Weak transcription	Spleen	Spleen
30	chr4:7791400-7800400	Strong transcription	IMR90 fetal lung fibroblasts Cell Line	lung
31	chr4:7791400-7806600	Weak transcription	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
32	chr4:7791600-7800000	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
33	chr4:7791600-7800400	Weak transcription	Left Ventricle	heart
34	chr4:7791600-7800400	Weak transcription	Right Ventricle	heart
35	chr4:7791600-7801200	Weak transcription	Fetal Brain Male	brain
36	chr4:7792200-7803200	Strong transcription	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
37	chr4:7792600-7802800	Strong transcription	ES-I3 Cell Line	embryonic stem cell
38	chr4:7792600-7803400	Strong transcription	A549	lung
39	chr4:7792800-7803000	Strong transcription	HSMMtube	muscle
40	chr4:7793200-7803800	Strong transcription	NH-A	brain
41	chr4:7794400-7803600	Weak transcription	Primary T helper memory cells from peripheral blood 1	blood
42	chr4:7794800-7803400	Strong transcription	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
43	chr4:7795600-7799800	Weak transcription	ES-UCSF4 Cell Line	embryonic stem cell
44	chr4:7795600-7800600	Weak transcription	H9 Cell Line	embryonic stem cell
45	chr4:7795600-7803800	Weak transcription	Fetal Kidney	kidney
46	chr4:7795800-7803800	Weak transcription	Fetal Heart	heart
47	chr4:7796000-7800400	Weak transcription	Colon Smooth Muscle	Colon
48	chr4:7796000-7803400	Strong transcription	HUVEC	blood vessel
49	chr4:7796600-7803400	Strong transcription	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
50	chr4:7796800-7804200	Strong transcription	NHEK	skin

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links