Variant report

Variant	rs570106600
Chromosome Location	chr4:47207732-47207733
allele	-/GAGCTTCTGCACTTACTGAGTCAAGAAA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 6 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:6 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv829922	chr4:47093785-47261181	Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer	Chromatin interactive region lncRNA	n/a	inside rSNPs	diseases
2	nsv879003	chr4:47102993-47215939	Enhancers Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer	Chromatin interactive region lncRNA	n/a	inside rSNPs	diseases
3	nsv1009766	chr4:47155845-47277391	Enhancers Flanking Active TSS Weak transcription Active TSS	lncRNA	n/a	inside rSNPs	diseases
4	nsv1013512	chr4:47178547-47213133	Enhancers Weak transcription Active TSS Flanking Active TSS	n/a	n/a	inside rSNPs	diseases
5	nsv537079	chr4:47178547-47213133	Weak transcription Enhancers Active TSS Flanking Active TSS	n/a	n/a	inside rSNPs	diseases
6	nsv998919	chr4:47207023-47476876	Weak transcription Active TSS Bivalent/Poised TSS Flanking Active TSS Strong transcription Enhancers Genic enhancers Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr4:47205200-47211600	Weak transcription	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links