Variant report

Variant	rs572396039
Chromosome Location	chr2:95737223-95737224
allele	-/ATGTTTTGATATATGTGTACATTGTGGA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 7 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:7 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1000661	chr2:95327875-95739468	Bivalent Enhancer Weak transcription Enhancers Strong transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	29 gene(s)	inside rSNPs	diseases
2	nsv1005016	chr2:95327875-95914467	Active TSS Enhancers ZNF genes & repeats Bivalent Enhancer Weak transcription Flanking Active TSS Bivalent/Poised TSS Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	43 gene(s)	inside rSNPs	diseases
3	nsv1003666	chr2:95618109-95772924	Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Strong transcription Flanking Active TSS Weak transcription Active TSS Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	14 gene(s)	inside rSNPs	diseases
4	nsv817258	chr2:95618109-96340788	Enhancers Active TSS Strong transcription Bivalent/Poised TSS Bivalent Enhancer Flanking Active TSS Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	59 gene(s)	inside rSNPs	diseases
5	nsv482276	chr2:95711972-95888406	Weak transcription Enhancers Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Active TSS Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	19 gene(s)	inside rSNPs	diseases
6	esv3390169	chr2:95735525-95737948	Enhancers Weak transcription Flanking Bivalent TSS/Enh	Chromatin interactive region	1 gene(s)	inside rSNPs	n/a
7	esv3337996	chr2:95735975-95737673	Enhancers Weak transcription	Chromatin interactive region	1 gene(s)	inside rSNPs	n/a

No data

Chromatin state (count:12 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr2:95729800-95737800	Weak transcription	Primary T cells from cord blood	blood
2	chr2:95729800-95740600	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
3	chr2:95732200-95742400	Weak transcription	Pancreas	Pancrea
4	chr2:95733400-95742400	Weak transcription	H9 Cell Line	embryonic stem cell
5	chr2:95734200-95742400	Weak transcription	Right Atrium	heart
6	chr2:95734600-95737400	Weak transcription	Brain Substantia Nigra	brain
7	chr2:95734800-95737400	Weak transcription	Brain Cingulate Gyrus	brain
8	chr2:95735600-95737600	Weak transcription	Fetal Thymus	thymus
9	chr2:95737200-95741400	Enhancers	Brain Inferior Temporal Lobe	brain
10	chr2:95737200-95742400	Enhancers	Brain Angular Gyrus	brain
11	chr2:95737200-95742400	Enhancers	Brain Anterior Caudate	brain
12	chr2:95737200-95742400	Enhancers	Brain Hippocampus Middle	brain

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links