Variant report

Variant	rs573278268
Chromosome Location	chr21:47879207-47879208
allele	-/GGACCCCCGCGCGGCCCCTCACTCCA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	POLR2A	chr21:47875376-47879258	SK-N-MC	brain:	n/a	n/a
2	POLR2A	chr21:47877696-47879214	ECC-1	luminal epithelium:	n/a	n/a
3	SIN3AK20	chr21:47877440-47879283	MCF-7	breast:	n/a	n/a
4	POLR2A	chr21:47877792-47879228	ProgFib	skin:	n/a	n/a
5	POLR2A	chr21:47877747-47879242	MCF-7	breast:	n/a	n/a
6	ZBTB7A	chr21:47878937-47879850	ECC-1	luminal epithelium:	n/a	n/a
7	ESRRA	chr21:47877446-47879271	GM12878	blood:	n/a	n/a
8	ZBTB7A	chr21:47879149-47879434	HepG2	liver:	n/a	n/a
9	MAX	chr21:47877669-47879265	HepG2	liver:	n/a	n/a
10	POLR2A	chr21:47878323-47879222	H1-neurons	neurons:	n/a	n/a
11	POLR2A	chr21:47877878-47879260	MCF-7	breast:	n/a	n/a
12	MXI1	chr21:47877463-47879400	SK-N-SH	brain:	n/a	n/a
13	POLR2A	chr21:47876732-47879341	HepG2	liver:	n/a	n/a
14	ZBTB7A	chr21:47878742-47879984	K562	blood:	n/a	n/a
15	TAF1	chr21:47877955-47879216	HepG2	liver:	n/a	n/a
16	MAX	chr21:47877588-47879255	MCF-7	breast:	n/a	n/a
17	SIN3AK20	chr21:47877968-47879227	PANC-1	pancreas:	n/a	n/a
18	POLR2A	chr21:47877576-47879244	Hela-S3	cervix:	n/a	n/a
19	YY1	chr21:47877968-47879295	HepG2	liver:	n/a	chr21:47878836-47878847 chr21:47878844-47878853
20	POLR2A	chr21:47877713-47879243	HUVEC	blood vessel:	n/a	n/a
21	MAX	chr21:47877731-47879234	ECC-1	luminal epithelium:	n/a	n/a
22	HCFC1	chr21:47877493-47879289	Hela-S3	cervix:	n/a	n/a
23	REST	chr21:47877920-47879337	H1-neurons	neurons:	n/a	n/a
24	YY1	chr21:47877844-47879288	K562	blood:	n/a	chr21:47878836-47878847 chr21:47878844-47878853
25	SP1	chr21:47878215-47879237	HCT-116	colon:	n/a	chr21:47878715-47878727 chr21:47879145-47879154 chr21:47879144-47879156 chr21:47878716-47878725 chr21:47878686-47878707 chr21:47879145-47879155 chr21:47879145-47879159 chr21:47879144-47879156 chr21:47878715-47878727 chr21:47878717-47878726 chr21:47879146-47879155
26	SIN3A	chr21:47877808-47879303	H1-hESC	embryonic stem cell:	n/a	chr21:47878833-47878846 chr21:47878634-47878645
27	TAF1	chr21:47877861-47879256	ECC-1	luminal epithelium:	n/a	n/a
28	POLR2A	chr21:47877619-47879214	HL-60	blood:	n/a	n/a
29	RFX5	chr21:47877319-47879399	SK-N-SH	brain:	n/a	chr21:47878712-47878721 chr21:47878708-47878723
30	ELF1	chr21:47877975-47879265	GM12878	blood:	n/a	chr21:47878720-47878732
31	MXI1	chr21:47877351-47879319	IMR90	lung:	n/a	n/a
32	MAX	chr21:47877844-47879218	H1-hESC	embryonic stem cell:	n/a	n/a
33	CREB1	chr21:47877684-47879259	HepG2	liver:	n/a	n/a
34	POLR2A	chr21:47877814-47879214	GM18951	blood:	n/a	n/a
35	UBTF	chr21:47877401-47879233	K562	blood:	n/a	n/a
36	POLR2A	chr21:47877856-47879222	Hela-S3	cervix:	n/a	n/a
37	JUN	chr21:47877391-47879234	K562	blood:	n/a	chr21:47877798-47877806
38	ZBTB7A	chr21:47879083-47879322	HepG2	liver:	n/a	n/a
39	POLR2A	chr21:47877463-47879398	PFSK-1	brain:	n/a	n/a
40	POLR2A	chr21:47877932-47879213	Gliobla	brain:	n/a	n/a
41	POLR2A	chr21:47877975-47879232	H1-neurons	neurons:	n/a	n/a
42	POLR2A	chr21:47877836-47879322	MCF-7	breast:	n/a	n/a
43	POLR2A	chr21:47877737-47879291	K562	blood:	n/a	n/a
44	FOXP2	chr21:47877983-47879226	PFSK-1	brain:	n/a	n/a
45	POLR2A	chr21:47877835-47879261	HUVEC	blood vessel:	n/a	n/a
46	PML	chr21:47877925-47879258	MCF-7	breast:	n/a	n/a
47	MAX	chr21:47877646-47879214	A549	lung:	n/a	n/a
48	SIN3AK20	chr21:47878744-47879261	K562	blood:	n/a	n/a
49	TCF12	chr21:47877965-47879257	ECC-1	luminal epithelium:	n/a	n/a
50	RCOR1	chr21:47877667-47879334	IMR90	lung:	n/a	n/a

No.	Distal block	Cell Line	Cell type
1	chr21:47858462..47860394-chr21:47879147..47880997,2	MCF-7	breast:
2	chr21:47743254..47746166-chr21:47876901..47880445,4	MCF-7	breast:
3	chr17:57921537..57925513-chr21:47876812..47880311,4	MCF-7	breast:
4	chr21:47877844..47879584-chr6:47445419..47446944,2	MCF-7	breast:
5	chr21:47875258..47880014-chr21:48054452..48058643,10	K562	blood:
6	chr21:47639323..47641508-chr21:47879024..47881708,2	MCF-7	breast:
7	chr21:47839369..47841083-chr21:47878532..47880064,2	K562	blood:
8	chr21:47743042..47745765-chr21:47875975..47879914,6	MCF-7	breast:
9	chr16:31470747..31471310-chr21:47878393..47879297,2	Hela-S3	cervix:
10	chr21:47647264..47648921-chr21:47877829..47879532,2	MCF-7	breast:
11	chr21:47706221..47707965-chr21:47878068..47881386,3	K562	blood:
12	chr21:47647264..47651365-chr21:47875652..47880068,5	K562	blood:
13	chr21:47647621..47651234-chr21:47875652..47881416,7	K562	blood:
14	chr21:47877118..47880921-chr21:48053345..48058142,9	K562	blood:
15	chr21:47648325..47649130-chr21:47878619..47879226,2	K562	blood:
16	chr21:47878168..47880063-chr21:48054664..48057491,4	MCF-7	breast:

Variant related genes	Relation type
DIP2A-IT1	TF binding region
ENSG00000160298	Chromatin interaction
ENSG00000198087	Chromatin interaction
ENSG00000260267	Chromatin interaction
ENSG00000225043	Chromatin interaction
ENSG00000201524	Chromatin interaction
ENSG00000223901	Chromatin interaction
ENSG00000160299	Chromatin interaction
ENSG00000160310	Chromatin interaction
ENSG00000160285	Chromatin interaction
ENSG00000215424	Chromatin interaction
ENSG00000140691	Chromatin interaction
ENSG00000182362	Chromatin interaction

Extended variants
information (count: 29 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:29 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1059230	chr21:46956877-47907990	Weak transcription Strong transcription Enhancers Flanking Active TSS Transcr. at gene 5' and 3' Active TSS Genic enhancers Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	94 gene(s)	inside rSNPs	n/a
2	nsv544491	chr21:46956877-47907990	Active TSS Weak transcription Strong transcription Enhancers Flanking Active TSS Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	94 gene(s)	inside rSNPs	n/a
3	nsv1065959	chr21:47188878-48091343	Bivalent Enhancer Enhancers Genic enhancers Strong transcription Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	102 gene(s)	inside rSNPs	n/a
4	nsv531580	chr21:47221774-48090317	Flanking Active TSS Bivalent/Poised TSS Strong transcription Active TSS Enhancers Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	101 gene(s)	inside rSNPs	n/a
5	nsv918103	chr21:47297067-48089510	Genic enhancers Weak transcription Flanking Active TSS Enhancers Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	99 gene(s)	inside rSNPs	n/a
6	nsv869002	chr21:47297268-47963186	Flanking Active TSS Weak transcription Active TSS Bivalent Enhancer Enhancers Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	73 gene(s)	inside rSNPs	n/a
7	nsv470910	chr21:47353775-48084988	Enhancers Weak transcription ZNF genes & repeats Strong transcription Genic enhancers Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	95 gene(s)	inside rSNPs	n/a
8	nsv1059118	chr21:47398331-48090457	Flanking Active TSS Weak transcription Strong transcription Active TSS Genic enhancers Enhancers ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	95 gene(s)	inside rSNPs	n/a
9	nsv544494	chr21:47398331-48090457	Strong transcription Weak transcription Bivalent Enhancer Enhancers Active TSS Genic enhancers Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	95 gene(s)	inside rSNPs	n/a
10	nsv934264	chr21:47401083-48090317	Genic enhancers Enhancers Strong transcription Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	95 gene(s)	inside rSNPs	n/a
11	nsv519904	chr21:47583506-47881309	Strong transcription Genic enhancers ZNF genes & repeats Flanking Active TSS Enhancers Active TSS Transcr. at gene 5' and 3' Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	56 gene(s)	inside rSNPs	n/a
12	nsv948761	chr21:47587940-48069930	Enhancers Flanking Active TSS Strong transcription Weak transcription Genic enhancers Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	83 gene(s)	inside rSNPs	n/a
13	nsv1055239	chr21:47591378-48090317	Enhancers Strong transcription Genic enhancers Weak transcription Flanking Active TSS Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	85 gene(s)	inside rSNPs	n/a
14	nsv544495	chr21:47591378-48090317	Weak transcription Enhancers Strong transcription Flanking Active TSS ZNF genes & repeats Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	85 gene(s)	inside rSNPs	n/a
15	nsv949706	chr21:47625544-48069930	Strong transcription Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Enhancers Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Active TSS Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	82 gene(s)	inside rSNPs	n/a
16	nsv529496	chr21:47634193-48090317	Weak transcription Strong transcription Genic enhancers Flanking Active TSS Enhancers Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	82 gene(s)	inside rSNPs	n/a
17	nsv914136	chr21:47681041-47900994	Active TSS Strong transcription Genic enhancers Enhancers ZNF genes & repeats Flanking Active TSS Weak transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	51 gene(s)	inside rSNPs	n/a
18	nsv933061	chr21:47746204-48031515	Enhancers Strong transcription Weak transcription Flanking Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	31 gene(s)	inside rSNPs	n/a
19	nsv1062858	chr21:47750884-48091343	Enhancers Genic enhancers Strong transcription Weak transcription Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	56 gene(s)	inside rSNPs	n/a
20	nsv1056321	chr21:47835146-47973412	Strong transcription Genic enhancers Weak transcription Enhancers Transcr. at gene 5' and 3' Flanking Active TSS ZNF genes & repeats Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	n/a
21	nsv917208	chr21:47836346-47988603	Weak transcription Strong transcription Enhancers Flanking Active TSS Genic enhancers Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	n/a
22	nsv1058397	chr21:47851176-48091343	Flanking Active TSS Strong transcription Enhancers Active TSS Weak transcription Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	56 gene(s)	inside rSNPs	n/a
23	nsv459312	chr21:47856106-47985655	Flanking Active TSS Strong transcription Weak transcription Enhancers Genic enhancers Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	n/a
24	nsv587998	chr21:47856106-47985655	Active TSS Weak transcription Strong transcription Enhancers Flanking Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	n/a
25	nsv1065502	chr21:47865215-48091343	Strong transcription Genic enhancers Enhancers Weak transcription Transcr. at gene 5' and 3' Flanking Active TSS Bivalent Enhancer Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	56 gene(s)	inside rSNPs	n/a
26	nsv1056152	chr21:47875370-47979259	Weak transcription Strong transcription ZNF genes & repeats Flanking Active TSS Active TSS Enhancers Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	n/a
27	nsv1061442	chr21:47875370-48091343	Weak transcription Strong transcription Genic enhancers Bivalent/Poised TSS Enhancers Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	56 gene(s)	inside rSNPs	n/a
28	esv3337772	chr21:47877824-47880672	Enhancers Flanking Active TSS Active TSS Weak transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	n/a
29	esv3437335	chr21:47878049-47880897	Active TSS Weak transcription Flanking Active TSS Enhancers Strong transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	n/a

No data

Chromatin state (count:127 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr21:47877200-47879800	Active TSS	iPS-20b Cell Line	embryonic stem cell
2	chr21:47877200-47880200	Active TSS	HUES48 Cell Line	embryonic stem cell
3	chr21:47877200-47880200	Active TSS	A549	lung
4	chr21:47877200-47880400	Active TSS	HUES64 Cell Line	embryonic stem cell
5	chr21:47877400-47879600	Active TSS	Foreskin Melanocyte Primary Cells skin01	Skin
6	chr21:47877400-47880000	Active TSS	ES-I3 Cell Line	embryonic stem cell
7	chr21:47877400-47880200	Active TSS	Fetal Kidney	kidney
8	chr21:47877400-47880200	Active TSS	NHLF	lung
9	chr21:47877400-47880400	Active TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
10	chr21:47877600-47879600	Active TSS	Fetal Muscle Trunk	muscle
11	chr21:47877600-47879600	Active TSS	Gastric	stomach
12	chr21:47877600-47879800	Active TSS	iPS DF 6.9 Cell Line	embryonic stem cell
13	chr21:47877600-47880000	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
14	chr21:47877600-47880200	Active TSS	Left Ventricle	heart
15	chr21:47877600-47880200	Active TSS	Ovary	ovary
16	chr21:47877600-47880200	Active TSS	Psoas Muscle	Psoas
17	chr21:47877600-47880400	Active TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
18	chr21:47877600-47880400	Active TSS	HSMMtube	muscle
19	chr21:47877600-47880600	Active TSS	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
20	chr21:47877800-47879600	Active TSS	Brain Inferior Temporal Lobe	brain
21	chr21:47877800-47879600	Active TSS	Sigmoid Colon	Sigmoid Colon
22	chr21:47877800-47879800	Active TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
23	chr21:47877800-47879800	Active TSS	Aorta	Aorta
24	chr21:47877800-47879800	Active TSS	GM12878-XiMat	blood
25	chr21:47877800-47880000	Active TSS	ES-WA7 Cell Line	embryonic stem cell
26	chr21:47877800-47880000	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
27	chr21:47877800-47880000	Active TSS	H9 Cell Line	embryonic stem cell
28	chr21:47877800-47880000	Active TSS	Small Intestine	intestine
29	chr21:47877800-47880200	Active TSS	iPS-15b Cell Line	embryonic stem cell
30	chr21:47877800-47880200	Active TSS	iPS-18 Cell Line	embryonic stem cell
31	chr21:47877800-47880400	Active TSS	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
32	chr21:47877800-47880600	Active TSS	NHDF-Ad	bronchial
33	chr21:47878000-47879400	Transcr. at gene 5' and 3'	Primary T helper naive cells fromperipheralblood	blood
34	chr21:47878000-47879600	Active TSS	H1 Derived Mesenchymal Stem Cells	ES cell derived
35	chr21:47878000-47879600	Active TSS	H9 Derived Neuron Cultured Cells	ES cell derived
36	chr21:47878000-47879600	Active TSS	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
37	chr21:47878000-47879600	Active TSS	Primary T helper naive cells from peripheral blood	blood
38	chr21:47878000-47879600	Active TSS	Primary T helper cells PMA-I stimulated	--
39	chr21:47878000-47879600	Active TSS	Brain Germinal Matrix	brain
40	chr21:47878000-47879600	Active TSS	Brain Hippocampus Middle	brain
41	chr21:47878000-47879600	Active TSS	Fetal Lung	lung
42	chr21:47878000-47879600	Active TSS	Fetal Muscle Leg	muscle
43	chr21:47878000-47879600	Active TSS	Placenta	Placenta
44	chr21:47878000-47879600	Active TSS	Fetal Stomach	stomach
45	chr21:47878000-47879600	Active TSS	Fetal Thymus	thymus
46	chr21:47878000-47879600	Active TSS	Lung	lung
47	chr21:47878000-47879600	Active TSS	Stomach Mucosa	stomach
48	chr21:47878000-47879600	Active TSS	Thymus	Thymus
49	chr21:47878000-47879600	Active TSS	Dnd41	blood
50	chr21:47878000-47879800	Active TSS	H1 Cell Line	embryonic stem cell

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links