Variant report

Variant rs573375640
Chromosome Location chr1:226076039-226076040
allele -/GGCTGCAGGAGGATTCAGGCC
Outlinks Ensembl   UCSC
Chromatin state (count:52 , 50 per page) page: 1 2
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:226071000-226076200 Weak transcription Small Intestine intestine
2 chr1:226071000-226076400 Weak transcription Spleen Spleen
3 chr1:226071000-226078600 Weak transcription Lung lung
4 chr1:226071000-226083600 Weak transcription Primary T killer memory cells from peripheral blood blood
5 chr1:226071200-226076200 Weak transcription iPS DF 6.9 Cell Line embryonic stem cell
6 chr1:226071200-226076200 Weak transcription Fetal Kidney kidney
7 chr1:226071200-226076200 Weak transcription A549 lung
8 chr1:226071200-226078200 Weak transcription Gastric stomach
9 chr1:226071200-226078200 Weak transcription HMEC breast
10 chr1:226071600-226076800 Weak transcription Duodenum Mucosa Duodenum
11 chr1:226071800-226076400 Weak transcription H1 Derived Mesenchymal Stem Cells ES cell derived
12 chr1:226071800-226076400 Weak transcription Placenta Placenta
13 chr1:226071800-226076800 Weak transcription K562 blood
14 chr1:226071800-226078800 Weak transcription Primary T cells from cord blood blood
15 chr1:226072000-226076800 Weak transcription Primary T cells fromperipheralblood blood
16 chr1:226072000-226081200 Weak transcription Primary T helper cells fromperipheralblood blood
17 chr1:226072000-226081600 Weak transcription Primary T regulatory cells fromperipheralblood blood
18 chr1:226072000-226082000 Weak transcription Primary T helper naive cells fromperipheralblood blood
19 chr1:226073000-226077000 Strong transcription Right Atrium heart
20 chr1:226073200-226079800 Enhancers Liver Liver
21 chr1:226074200-226077000 Active TSS ES-I3 Cell Line embryonic stem cell
22 chr1:226074400-226076800 Active TSS Rectal Mucosa Donor 29 rectum
23 chr1:226074400-226077200 Active TSS Rectal Smooth Muscle rectum
24 chr1:226074600-226076200 Active TSS HUES48 Cell Line embryonic stem cell
25 chr1:226074600-226076200 Weak transcription Sigmoid Colon Sigmoid Colon
26 chr1:226074600-226076600 Weak transcription Stomach Mucosa stomach
27 chr1:226074800-226076800 Weak transcription Fetal Intestine Large intestine
28 chr1:226074800-226078800 Enhancers Fetal Stomach stomach
29 chr1:226075000-226076400 Active TSS H9 Cell Line embryonic stem cell
30 chr1:226075000-226076600 Active TSS Rectal Mucosa Donor 31 rectum
31 chr1:226075000-226076800 Bivalent/Poised TSS HUES64 Cell Line embryonic stem cell
32 chr1:226075200-226076600 Weak transcription Fetal Intestine Small intestine
33 chr1:226075200-226077200 Active TSS Colonic Mucosa Colon
34 chr1:226075400-226076800 Active TSS Pancreatic Islets Pancreatic Islet
35 chr1:226075400-226079200 Enhancers Ovary ovary
36 chr1:226075600-226076200 Bivalent/Poised TSS iPS-18 Cell Line embryonic stem cell
37 chr1:226075600-226076600 Bivalent Enhancer Fetal Muscle Leg muscle
38 chr1:226075600-226076800 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
39 chr1:226075600-226076800 Transcr. at gene 5' and 3' hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
40 chr1:226075800-226076200 Bivalent Enhancer Foreskin Fibroblast Primary Cells skin02 Skin
41 chr1:226075800-226076400 Enhancers iPS DF 19.11 Cell Line embryonic stem cell
42 chr1:226075800-226076800 Active TSS ES-WA7 Cell Line embryonic stem cell
43 chr1:226075800-226077000 Bivalent Enhancer Fetal Muscle Trunk muscle
44 chr1:226075800-226077600 Bivalent Enhancer H1 Cell Line embryonic stem cell
45 chr1:226075800-226079000 Enhancers ES-UCSF4 Cell Line embryonic stem cell
46 chr1:226076000-226076200 Active TSS Pancreas Pancrea
47 chr1:226076000-226076400 Flanking Bivalent TSS/Enh HUES6 Cell Line embryonic stem cell
48 chr1:226076000-226076400 Flanking Bivalent TSS/Enh iPS-15b Cell Line embryonic stem cell
49 chr1:226076000-226076400 Flanking Active TSS HepG2 liver
50 chr1:226076000-226076800 Flanking Active TSS Fetal Lung lung

Quick Search:


  
Input of quick search could be:

what's new

Quick links