Variant report

Variant	rs574085444
Chromosome Location	chr15:74721620-74721621
allele	-/CCCCCTGAGGGCTGCCAGACCTGC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr15:74720298..74721801-chr15:74727091..74728921,2	MCF-7	breast:
2	chr15:74715079..74717127-chr15:74720885..74723638,2	MCF-7	breast:
3	chr15:74720324..74723910-chr15:74723921..74727050,4	MCF-7	breast:
4	chr15:74664841..74669022-chr15:74717731..74721779,3	K562	blood:
5	chr15:74687904..74690050-chr15:74721010..74722729,2	MCF-7	breast:
6	chr15:74673143..74676106-chr15:74720304..74723999,3	K562	blood:

Variant related genes	Relation type
ENSG00000138623	Chromatin interaction

Extended variants
information (count: 28 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:28 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv428641	chr15:74555113-74724630	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Active TSS Strong transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	34 gene(s)	inside rSNPs	diseases
2	nsv482615	chr15:74593625-74757962	Enhancers Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Weak transcription Strong transcription Bivalent Enhancer Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA	58 gene(s)	inside rSNPs	diseases
3	nsv904354	chr15:74697084-74722924	Enhancers Genic enhancers Flanking Active TSS Strong transcription Weak transcription Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats Active TSS	TF binding region CpG island Chromatin interactive region miRNA	4 gene(s)	inside rSNPs	diseases
4	nsv904355	chr15:74697084-74728149	Enhancers Flanking Active TSS Weak transcription Strong transcription Bivalent/Poised TSS Genic enhancers Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region miRNA	11 gene(s)	inside rSNPs	diseases
5	nsv904356	chr15:74697084-74729603	Flanking Active TSS Enhancers Genic enhancers Weak transcription Active TSS Strong transcription Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region miRNA	11 gene(s)	inside rSNPs	diseases
6	nsv569974	chr15:74701200-74727113	Strong transcription Flanking Active TSS Enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS Weak transcription Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region miRNA	11 gene(s)	inside rSNPs	diseases
7	nsv904360	chr15:74709071-74728149	Genic enhancers Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Flanking Active TSS Weak transcription Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
8	nsv569979	chr15:74709405-74722924	Flanking Active TSS Enhancers Bivalent Enhancer Weak transcription Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3'	Chromatin interactive region	4 gene(s)	inside rSNPs	diseases
9	nsv904364	chr15:74709975-74728149	Enhancers Bivalent Enhancer Flanking Active TSS Weak transcription Active TSS Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
10	nsv569982	chr15:74710125-74721969	Genic enhancers Enhancers Bivalent Enhancer Weak transcription Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Active TSS	Chromatin interactive region	4 gene(s)	inside rSNPs	diseases
11	nsv904367	chr15:74710125-74728149	Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Weak transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Strong transcription	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
12	nsv904368	chr15:74711122-74728149	Bivalent Enhancer Genic enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Active TSS Weak transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
13	nsv542433	chr15:74714265-74745033	Weak transcription Genic enhancers Flanking Active TSS Bivalent Enhancer Strong transcription Enhancers Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases
14	nsv904370	chr15:74718699-74722924	Enhancers Genic enhancers Weak transcription Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Active TSS Strong transcription Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
15	nsv904371	chr15:74719249-74731330	Active TSS Flanking Active TSS Enhancers Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
16	nsv569985	chr15:74719297-74722061	Enhancers Weak transcription Strong transcription Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
17	nsv904372	chr15:74719369-74722924	Weak transcription Enhancers Flanking Active TSS Strong transcription Genic enhancers Bivalent Enhancer Active TSS Transcr. at gene 5' and 3'	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
18	nsv904373	chr15:74719531-74721905	Enhancers Flanking Active TSS Strong transcription Genic enhancers Weak transcription Transcr. at gene 5' and 3' Bivalent Enhancer Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
19	nsv569986	chr15:74719531-74722924	Strong transcription Transcr. at gene 5' and 3' Weak transcription Flanking Active TSS Genic enhancers Enhancers Bivalent Enhancer Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
20	nsv904374	chr15:74719561-74723291	Enhancers Weak transcription Strong transcription Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Active TSS Active TSS Bivalent/Poised TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
21	nsv904375	chr15:74719998-74722924	Flanking Active TSS Enhancers Bivalent Enhancer Strong transcription Transcr. at gene 5' and 3' Weak transcription Active TSS Genic enhancers	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
22	nsv904376	chr15:74719998-74723291	Flanking Active TSS Transcr. at gene 5' and 3' Weak transcription Genic enhancers Bivalent Enhancer Enhancers Strong transcription Active TSS Bivalent/Poised TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
23	nsv569987	chr15:74720076-74722061	Transcr. at gene 5' and 3' Flanking Active TSS Bivalent Enhancer Enhancers Weak transcription Active TSS Genic enhancers Strong transcription	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
24	nsv569988	chr15:74720076-74722924	Transcr. at gene 5' and 3' Weak transcription Flanking Active TSS Enhancers Genic enhancers Bivalent Enhancer Strong transcription Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
25	nsv904377	chr15:74720164-74723291	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Active TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
26	nsv569989	chr15:74720443-74722924	Flanking Active TSS Weak transcription Enhancers Strong transcription Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
27	nsv904378	chr15:74720443-74723291	Enhancers Bivalent Enhancer Flanking Active TSS Transcr. at gene 5' and 3' Weak transcription Genic enhancers Strong transcription Active TSS Bivalent/Poised TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
28	nsv569990	chr15:74721171-74722924	Enhancers Weak transcription Flanking Active TSS Genic enhancers Bivalent Enhancer Strong transcription Active TSS Transcr. at gene 5' and 3'	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:88 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr15:74707200-74722400	Weak transcription	Fetal Intestine Small	intestine
2	chr15:74708400-74722400	Genic enhancers	Fetal Thymus	thymus
3	chr15:74709200-74724800	Weak transcription	Primary T cells from cord blood	blood
4	chr15:74710000-74722800	Genic enhancers	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
5	chr15:74710200-74722000	Weak transcription	Dnd41	blood
6	chr15:74710400-74722800	Enhancers	Brain Hippocampus Middle	brain
7	chr15:74711000-74723200	Enhancers	Fetal Adrenal Gland	Adrenal Gland
8	chr15:74711000-74723400	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
9	chr15:74713000-74724000	Weak transcription	Gastric	stomach
10	chr15:74713200-74725000	Transcr. at gene 5' and 3'	GM12878-XiMat	blood
11	chr15:74713400-74724400	Weak transcription	Primary T killer naive cells fromperipheralblood	blood
12	chr15:74713400-74725200	Weak transcription	Primary T helper naive cells from peripheral blood	blood
13	chr15:74715000-74722600	Enhancers	Brain Inferior Temporal Lobe	brain
14	chr15:74715600-74724800	Weak transcription	Lung	lung
15	chr15:74715800-74721800	Weak transcription	Duodenum Mucosa	Duodenum
16	chr15:74716000-74722000	Weak transcription	Skeletal Muscle Female	skeletal muscle
17	chr15:74716200-74723400	Weak transcription	iPS-18 Cell Line	embryonic stem cell
18	chr15:74716200-74724000	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
19	chr15:74716200-74724800	Weak transcription	H9 Cell Line	embryonic stem cell
20	chr15:74716200-74725000	Weak transcription	A549	lung
21	chr15:74716400-74722000	Weak transcription	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
22	chr15:74716400-74722200	Genic enhancers	Spleen	Spleen
23	chr15:74716600-74721800	Weak transcription	H1 Cell Line	embryonic stem cell
24	chr15:74716600-74725000	Weak transcription	Right Atrium	heart
25	chr15:74717000-74723000	Genic enhancers	Foreskin Keratinocyte Primary Cells skin03	Skin
26	chr15:74717600-74722400	Weak transcription	ES-I3 Cell Line	embryonic stem cell
27	chr15:74718000-74723400	Weak transcription	Breast Myoepithelial Primary Cells	Breast
28	chr15:74718200-74721800	Weak transcription	Primary T killer memory cells from peripheral blood	blood
29	chr15:74719000-74723200	Enhancers	Brain Substantia Nigra	brain
30	chr15:74719000-74724600	Transcr. at gene 5' and 3'	Foreskin Fibroblast Primary Cells skin01	Skin
31	chr15:74719400-74721800	Enhancers	K562	blood
32	chr15:74719600-74722200	Bivalent Enhancer	Fetal Muscle Trunk	muscle
33	chr15:74719600-74723200	Enhancers	Brain Cingulate Gyrus	brain
34	chr15:74719800-74722200	Strong transcription	NHEK	skin
35	chr15:74719800-74722800	Enhancers	Placenta	Placenta
36	chr15:74720000-74722000	Enhancers	iPS DF 19.11 Cell Line	embryonic stem cell
37	chr15:74720000-74723600	Enhancers	IMR90 fetal lung fibroblasts Cell Line	lung
38	chr15:74720000-74724000	Enhancers	Brain Anterior Caudate	brain
39	chr15:74720200-74722200	Enhancers	Brain Dorsolateral Prefrontal Cortex	brain
40	chr15:74720200-74722400	Enhancers	ES-WA7 Cell Line	embryonic stem cell
41	chr15:74720200-74722400	Enhancers	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
42	chr15:74720200-74722400	Enhancers	Primary monocytes fromperipheralblood	blood
43	chr15:74720200-74725200	Transcr. at gene 5' and 3'	Foreskin Fibroblast Primary Cells skin02	Skin
44	chr15:74720400-74721800	Enhancers	Foreskin Melanocyte Primary Cells skin01	Skin
45	chr15:74720400-74722200	Enhancers	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
46	chr15:74720400-74722200	Enhancers	Rectal Mucosa Donor 29	rectum
47	chr15:74720400-74722400	Enhancers	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
48	chr15:74720400-74723400	Enhancers	NHLF	lung
49	chr15:74720600-74721800	Enhancers	Monocytes-CD14+_RO01746	blood
50	chr15:74720600-74721800	Enhancers	NH-A	brain

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links