Variant report

Variant rs576317817
Chromosome Location chr1:209945206-209945207
allele -/GTGTACGTGTGCATGTGGAG
Outlinks Ensembl   UCSC
Chromatin state (count:80 , 50 per page) page: 1 2
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:209940800-209946200 Enhancers Fetal Stomach stomach
2 chr1:209941000-209945800 Flanking Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
3 chr1:209942000-209945400 Enhancers Placenta Placenta
4 chr1:209942800-209956800 Weak transcription Small Intestine intestine
5 chr1:209942800-209957200 Weak transcription H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
6 chr1:209943200-209945400 Enhancers Lung lung
7 chr1:209943200-209945600 Flanking Active TSS Primary T helper cells fromperipheralblood blood
8 chr1:209943200-209950600 Weak transcription Psoas Muscle Psoas
9 chr1:209943400-209945400 Enhancers Primary hematopoietic stem cells short term culture blood
10 chr1:209943400-209952600 Weak transcription Fetal Intestine Small intestine
11 chr1:209943600-209945600 Enhancers Primary hematopoietic stem cells blood
12 chr1:209943600-209945600 Enhancers Gastric stomach
13 chr1:209943600-209945800 Flanking Active TSS Primary T helper cells PMA-I stimulated --
14 chr1:209943600-209951000 Weak transcription HSMMtube muscle
15 chr1:209943600-209956600 Weak transcription Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
16 chr1:209943800-209945400 ZNF genes & repeats H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
17 chr1:209943800-209945600 Flanking Active TSS Primary T cells fromperipheralblood blood
18 chr1:209943800-209945600 Enhancers Duodenum Smooth Muscle Duodenum
19 chr1:209943800-209950800 Weak transcription Fetal Muscle Leg muscle
20 chr1:209943800-209954600 Weak transcription NHEK skin
21 chr1:209943800-209956600 Weak transcription Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
22 chr1:209943800-209956600 Weak transcription Brain Hippocampus Middle brain
23 chr1:209943800-209957000 Weak transcription Foreskin Melanocyte Primary Cells skin03 Skin
24 chr1:209943800-209957200 Weak transcription IMR90 fetal lung fibroblasts Cell Line lung
25 chr1:209944000-209945800 Enhancers Fetal Heart heart
26 chr1:209944000-209946000 Enhancers Stomach Smooth Muscle stomach
27 chr1:209944000-209946200 Enhancers Primary hematopoietic stem cells G-CSF-mobilized Female --
28 chr1:209944000-209952800 Weak transcription HMEC breast
29 chr1:209944000-209956000 Weak transcription Breast Myoepithelial Primary Cells Breast
30 chr1:209944000-209956600 Weak transcription Foreskin Fibroblast Primary Cells skin02 Skin
31 chr1:209944200-209945800 Weak transcription Primary neutrophils fromperipheralblood blood
32 chr1:209944200-209946400 Transcr. at gene 5' and 3' Primary T cells from cord blood blood
33 chr1:209944400-209945800 Flanking Active TSS Primary T helper naive cells from peripheral blood blood
34 chr1:209944400-209947200 Weak transcription Right Atrium heart
35 chr1:209944400-209948800 Genic enhancers Monocytes-CD14+_RO01746 blood
36 chr1:209944600-209946000 Genic enhancers Fetal Thymus thymus
37 chr1:209944600-209946400 Genic enhancers Thymus Thymus
38 chr1:209944600-209954400 Weak transcription Fetal Muscle Trunk muscle
39 chr1:209944800-209945400 Weak transcription K562 blood
40 chr1:209944800-209946000 Genic enhancers Primary monocytes fromperipheralblood blood
41 chr1:209944800-209946200 Transcr. at gene 5' and 3' Primary T helper naive cells fromperipheralblood blood
42 chr1:209944800-209947800 Genic enhancers Primary B cells from cord blood blood
43 chr1:209944800-209950000 Genic enhancers Primary B cells from peripheral blood blood
44 chr1:209944800-209951200 Weak transcription Sigmoid Colon Sigmoid Colon
45 chr1:209944800-209955200 Weak transcription Foreskin Keratinocyte Primary Cells skin03 Skin
46 chr1:209944800-209956600 Weak transcription Brain Inferior Temporal Lobe brain
47 chr1:209944800-209956600 Weak transcription Right Ventricle heart
48 chr1:209945000-209945400 Enhancers Primary T helper memory cells from peripheral blood 2 blood
49 chr1:209945000-209945400 Enhancers Primary T helper memory cells from peripheral blood 1 blood
50 chr1:209945000-209945400 Enhancers Primary T killer naive cells fromperipheralblood blood

Quick Search:


  
Input of quick search could be:

what's new

Quick links