Variant report

Variant	rs577329286
Chromosome Location	chr12:117623812-117623813
allele	-/GGATTACAGGTGTGTACCACCACACCCA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr12:117616960..117620689-chr12:117621446..117624982,5	K562	blood:
2	chr12:117621580..117624392-chr12:117625961..117628023,2	K562	blood:
3	chr12:117619225..117621566-chr12:117623434..117626120,2	MCF-7	breast:

Variant related genes	Relation type
ENSG00000135108	Chromatin interaction

Extended variants
information (count: 5 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:5 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv832526	chr12:117530234-117723821	Strong transcription Enhancers Active TSS Weak transcription Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	14 gene(s)	inside rSNPs	diseases
2	esv3409292	chr12:117613281-117638743	ZNF genes & repeats Strong transcription Enhancers Weak transcription Flanking Active TSS Active TSS Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	4 gene(s)	inside rSNPs	n/a
3	nsv510592	chr12:117618872-117684713	Bivalent/Poised TSS Strong transcription Enhancers Active TSS Transcr. at gene 5' and 3' Flanking Active TSS Weak transcription ZNF genes & repeats Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	n/a
4	nsv560346	chr12:117623651-117642113	Bivalent/Poised TSS Active TSS Weak transcription Flanking Active TSS Strong transcription Enhancers Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	4 gene(s)	inside rSNPs	n/a
5	nsv560347	chr12:117623651-117643067	Weak transcription Enhancers Strong transcription Active TSS Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	4 gene(s)	inside rSNPs	n/a

No data

Chromatin state (count:127 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr12:117580000-117625000	Strong transcription	Primary T cells fromperipheralblood	blood
2	chr12:117580000-117626800	Weak transcription	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
3	chr12:117580600-117625600	Strong transcription	Primary Natural Killer cells fromperipheralblood	blood
4	chr12:117581200-117624600	Strong transcription	Duodenum Mucosa	Duodenum
5	chr12:117581400-117624200	Strong transcription	Primary T helper naive cells fromperipheralblood	blood
6	chr12:117581400-117625800	Strong transcription	Primary T regulatory cells fromperipheralblood	blood
7	chr12:117582200-117625800	Strong transcription	Foreskin Keratinocyte Primary Cells skin03	Skin
8	chr12:117582400-117624400	Strong transcription	Breast Myoepithelial Primary Cells	Breast
9	chr12:117585800-117625600	Strong transcription	Primary T helper cells PMA-I stimulated	--
10	chr12:117590000-117626200	Strong transcription	HUES48 Cell Line	embryonic stem cell
11	chr12:117590200-117626800	Weak transcription	ES-WA7 Cell Line	embryonic stem cell
12	chr12:117590600-117625400	Strong transcription	Sigmoid Colon	Sigmoid Colon
13	chr12:117590600-117625600	Strong transcription	iPS-20b Cell Line	embryonic stem cell
14	chr12:117590600-117625600	Strong transcription	Monocytes-CD14+_RO01746	blood
15	chr12:117590600-117625800	Strong transcription	HUES64 Cell Line	embryonic stem cell
16	chr12:117590800-117625200	Strong transcription	Brain Anterior Caudate	brain
17	chr12:117591000-117624600	Strong transcription	Primary T helper cells fromperipheralblood	blood
18	chr12:117593800-117625000	Strong transcription	H1 Cell Line	embryonic stem cell
19	chr12:117593800-117625600	Strong transcription	HUES6 Cell Line	embryonic stem cell
20	chr12:117593800-117625600	Strong transcription	Placenta	Placenta
21	chr12:117593800-117625800	Strong transcription	ES-UCSF4 Cell Line	embryonic stem cell
22	chr12:117594000-117625800	Strong transcription	iPS-18 Cell Line	embryonic stem cell
23	chr12:117597600-117624400	Strong transcription	Fetal Intestine Large	intestine
24	chr12:117598600-117624600	Strong transcription	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
25	chr12:117602200-117624600	Strong transcription	Primary B cells from cord blood	blood
26	chr12:117603400-117624600	Strong transcription	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
27	chr12:117607800-117624600	Strong transcription	Foreskin Keratinocyte Primary Cells skin02	Skin
28	chr12:117607800-117624600	Strong transcription	Brain Inferior Temporal Lobe	brain
29	chr12:117608400-117624600	Strong transcription	Brain Cingulate Gyrus	brain
30	chr12:117609800-117624800	Strong transcription	Primary T helper 17 cells PMA-I stimulated	--
31	chr12:117610800-117624400	Strong transcription	Liver	Liver
32	chr12:117613400-117627400	Weak transcription	Small Intestine	intestine
33	chr12:117613600-117626400	Weak transcription	NHLF	lung
34	chr12:117613600-117626800	Weak transcription	Right Ventricle	heart
35	chr12:117614000-117626800	Weak transcription	Colonic Mucosa	Colon
36	chr12:117614200-117626600	Weak transcription	iPS-15b Cell Line	embryonic stem cell
37	chr12:117615000-117626800	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
38	chr12:117615400-117624000	Weak transcription	HSMMtube	muscle
39	chr12:117616400-117626000	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
40	chr12:117616400-117626800	Weak transcription	Psoas Muscle	Psoas
41	chr12:117616400-117627000	Weak transcription	Right Atrium	heart
42	chr12:117616600-117626000	Strong transcription	NH-A	brain
43	chr12:117616800-117626000	Weak transcription	Lung	lung
44	chr12:117617200-117624400	Strong transcription	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
45	chr12:117617600-117625400	Weak transcription	Primary T helper memory cells from peripheral blood 1	blood
46	chr12:117618800-117624600	Strong transcription	Fetal Kidney	kidney
47	chr12:117619400-117624000	Weak transcription	ES-I3 Cell Line	embryonic stem cell
48	chr12:117619400-117624600	Strong transcription	Primary mononuclear cells fromperipheralblood	Blood
49	chr12:117619400-117624800	Strong transcription	Primary hematopoietic stem cells G-CSF-mobilized Female	--
50	chr12:117619400-117626400	Weak transcription	Fetal Heart	heart

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links