Variant report

Variant	rs58571201
Chromosome Location	chr14:105538437-105538438
allele	-/TGCCCGTCCACACGCCCGCC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr14:105526681..105528779-chr14:105538234..105540945,2	K562	blood:
2	chr14:105523701..105528430-chr14:105538405..105542749,4	K562	blood:
3	chr14:105537608..105540428-chr14:105542339..105544754,4	MCF-7	breast:

Variant related genes	Relation type
ENSG00000183484	Chromatin interaction

Extended variants
information (count: 39 )
Associated
traits (count: 0)

rSNPs within LD-proxies of this variant (count:16)

rs_ID	r²[population]
rs56879552	0.92[ASN][1000 genomes]
rs57029322	0.92[ASN][1000 genomes]
rs57510708	0.92[ASN][1000 genomes]
rs59870288	0.92[ASN][1000 genomes]
rs59889078	0.88[ASN][1000 genomes]
rs60132793	0.96[AFR][1000 genomes]
rs60317283	0.92[ASN][1000 genomes]
rs60664931	0.84[ASN][1000 genomes]
rs61274642	0.88[ASN][1000 genomes]
rs74092707	0.96[AFR][1000 genomes]
rs74092710	0.96[AFR][1000 genomes]
rs74092711	0.96[AFR][1000 genomes]
rs74092713	0.96[AFR][1000 genomes]
rs8017360	0.96[AFR][1000 genomes]
rs8021519	0.92[AFR][1000 genomes]
rs8021521	0.91[AFR][1000 genomes]

Variant overlapped rSNPs/rCNVs (count:23 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv1828345	chr14:105100787-105803170	Weak transcription Enhancers Strong transcription Genic enhancers Flanking Active TSS Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	165 gene(s)	inside rSNPs	diseases
2	nsv542225	chr14:105133688-105803170	Enhancers Bivalent/Poised TSS Flanking Active TSS Bivalent Enhancer Weak transcription Active TSS Strong transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	165 gene(s)	inside rSNPs	diseases
3	nsv542227	chr14:105157572-105803170	Enhancers Flanking Active TSS Genic enhancers Weak transcription Active TSS Strong transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	147 gene(s)	inside rSNPs	diseases
4	nsv917106	chr14:105339195-105803170	Enhancers Flanking Active TSS Weak transcription Active TSS Bivalent Enhancer Bivalent/Poised TSS Strong transcription Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	94 gene(s)	inside rSNPs	diseases
5	nsv456457	chr14:105404384-105555396	Flanking Active TSS Enhancers Transcr. at gene 5' and 3' Strong transcription Weak transcription Flanking Bivalent TSS/Enh Active TSS Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	63 gene(s)	inside rSNPs	diseases
6	nsv566141	chr14:105404384-105555396	Weak transcription Flanking Bivalent TSS/Enh Active TSS Enhancers Bivalent/Poised TSS Flanking Active TSS Bivalent Enhancer Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	63 gene(s)	inside rSNPs	diseases
7	nsv902421	chr14:105410183-105574843	Weak transcription Enhancers Genic enhancers Active TSS Flanking Active TSS Strong transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	73 gene(s)	inside rSNPs	diseases
8	nsv902422	chr14:105420215-105803170	Enhancers Flanking Bivalent TSS/Enh Flanking Active TSS Weak transcription Active TSS Genic enhancers ZNF genes & repeats Strong transcription Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	88 gene(s)	inside rSNPs	diseases
9	nsv1052190	chr14:105423761-105722653	Weak transcription Enhancers Strong transcription Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	81 gene(s)	inside rSNPs	diseases
10	nsv902423	chr14:105430890-105803170	Enhancers Bivalent Enhancer Flanking Active TSS Weak transcription Strong transcription Genic enhancers Active TSS ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	88 gene(s)	inside rSNPs	diseases
11	nsv1042303	chr14:105435649-105633544	Bivalent Enhancer Flanking Active TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription Active TSS ZNF genes & repeats Strong transcription Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	73 gene(s)	inside rSNPs	diseases
12	nsv456458	chr14:105435649-105690092	Flanking Active TSS Weak transcription Enhancers Bivalent Enhancer Strong transcription Active TSS Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	77 gene(s)	inside rSNPs	diseases
13	nsv566150	chr14:105435649-105690092	Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Active TSS Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	77 gene(s)	inside rSNPs	diseases
14	nsv902424	chr14:105436222-105803170	Genic enhancers Weak transcription Enhancers Bivalent Enhancer Strong transcription Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	86 gene(s)	inside rSNPs	diseases
15	nsv566151	chr14:105459140-105555396	Flanking Active TSS Weak transcription Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Active TSS Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	43 gene(s)	inside rSNPs	diseases
16	nsv456459	chr14:105459140-105617891	Weak transcription Flanking Active TSS Enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Active TSS Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	55 gene(s)	inside rSNPs	diseases
17	nsv566152	chr14:105459140-105617891	Weak transcription Bivalent Enhancer Genic enhancers Strong transcription Enhancers Active TSS ZNF genes & repeats Flanking Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	55 gene(s)	inside rSNPs	diseases
18	nsv902425	chr14:105463936-105690092	Active TSS Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Weak transcription ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	60 gene(s)	inside rSNPs	diseases
19	nsv9175	chr14:105496509-105688941	Enhancers Strong transcription Bivalent/Poised TSS Active TSS Weak transcription Bivalent Enhancer ZNF genes & repeats Genic enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	35 gene(s)	inside rSNPs	diseases
20	nsv902427	chr14:105508577-105585347	Enhancers Flanking Active TSS Bivalent/Poised TSS Active TSS Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Strong transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
21	esv2758369	chr14:105513346-105803170	Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Active TSS Enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Strong transcription Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	42 gene(s)	inside rSNPs	diseases
22	esv2760014	chr14:105513346-105803170	Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Enhancers Flanking Active TSS Active TSS Bivalent/Poised TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	42 gene(s)	inside rSNPs	diseases
23	nsv902428	chr14:105531945-105555396	Bivalent/Poised TSS Flanking Active TSS Active TSS Weak transcription Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:36 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr14:105528800-105542000	Weak transcription	Right Atrium	heart
2	chr14:105531400-105542800	Weak transcription	Gastric	stomach
3	chr14:105532600-105538800	Enhancers	Primary monocytes fromperipheralblood	blood
4	chr14:105533800-105541200	Weak transcription	Lung	lung
5	chr14:105536000-105538600	Enhancers	H1 Derived Mesenchymal Stem Cells	ES cell derived
6	chr14:105536000-105539400	Enhancers	Spleen	Spleen
7	chr14:105536400-105538800	Weak transcription	Right Ventricle	heart
8	chr14:105536800-105541800	Weak transcription	NH-A	brain
9	chr14:105537000-105541000	Weak transcription	A549	lung
10	chr14:105537000-105541200	Weak transcription	Primary T helper naive cells from peripheral blood	blood
11	chr14:105537200-105540800	Weak transcription	Primary T regulatory cells fromperipheralblood	blood
12	chr14:105537200-105541000	Weak transcription	Primary T helper cells PMA-I stimulated	--
13	chr14:105537200-105541000	Weak transcription	Primary T cells effector/memory enriched fromperipheralblood	blood
14	chr14:105537200-105541200	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
15	chr14:105537200-105541200	Weak transcription	HSMM	muscle
16	chr14:105537200-105541800	Weak transcription	Primary T helper memory cells from peripheral blood 1	blood
17	chr14:105537200-105542000	Weak transcription	Primary T helper memory cells from peripheral blood 2	blood
18	chr14:105537200-105542000	Weak transcription	K562	blood
19	chr14:105537400-105538800	Enhancers	GM12878-XiMat	blood
20	chr14:105537400-105538800	Enhancers	Monocytes-CD14+_RO01746	blood
21	chr14:105537400-105540600	Weak transcription	Primary T helper naive cells fromperipheralblood	blood
22	chr14:105537400-105541000	Weak transcription	Primary T killer naive cells fromperipheralblood	blood
23	chr14:105537400-105541000	Weak transcription	Primary T killer memory cells from peripheral blood	blood
24	chr14:105537600-105540400	Weak transcription	Primary hematopoietic stem cells G-CSF-mobilized Female	--
25	chr14:105537800-105541000	Weak transcription	Primary T helper cells fromperipheralblood	blood
26	chr14:105538000-105539000	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
27	chr14:105538000-105540400	Weak transcription	Primary hematopoietic stem cells	blood
28	chr14:105538000-105540400	Weak transcription	Primary hematopoietic stem cells G-CSF-mobilized Male	--
29	chr14:105538000-105540800	Weak transcription	Fetal Thymus	thymus
30	chr14:105538000-105541200	Weak transcription	Primary T helper 17 cells PMA-I stimulated	--
31	chr14:105538000-105541200	Weak transcription	HSMMtube	muscle
32	chr14:105538000-105541800	Weak transcription	Primary neutrophils fromperipheralblood	blood
33	chr14:105538200-105540600	Weak transcription	Primary Natural Killer cells fromperipheralblood	blood
34	chr14:105538200-105541800	Weak transcription	Primary B cells from cord blood	blood
35	chr14:105538400-105538600	Bivalent Enhancer	Foreskin Melanocyte Primary Cells skin01	Skin
36	chr14:105538400-105540600	Weak transcription	Primary B cells from peripheral blood	blood

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links