Variant report

Variant rs587691401
Chromosome Location chr1:150526226-150526227
allele -/CAGAGCCCAGGCCTCTGGCA
Outlinks Ensembl   UCSC
Chromatin state (count:113 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr1:150521600-150532600 Weak transcription Brain Angular Gyrus brain
2 chr1:150522000-150526400 Flanking Active TSS Monocytes-CD14+_RO01746 blood
3 chr1:150522400-150532800 Weak transcription Cortex derived primary cultured neurospheres brain
4 chr1:150522600-150530200 Weak transcription Ganglion Eminence derived primary cultured neurospheres brain
5 chr1:150522600-150531200 Weak transcription Brain Substantia Nigra brain
6 chr1:150522600-150532200 Weak transcription H9 Derived Neuron Cultured Cells ES cell derived
7 chr1:150522800-150526400 Enhancers Primary Natural Killer cells fromperipheralblood blood
8 chr1:150522800-150526600 Enhancers IMR90 fetal lung fibroblasts Cell Line lung
9 chr1:150522800-150527200 Enhancers iPS DF 19.11 Cell Line embryonic stem cell
10 chr1:150522800-150527400 Enhancers Breast Myoepithelial Primary Cells Breast
11 chr1:150522800-150528000 Weak transcription Aorta Aorta
12 chr1:150522800-150532200 Weak transcription Sigmoid Colon Sigmoid Colon
13 chr1:150523000-150526400 Enhancers H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
14 chr1:150523200-150528000 Weak transcription Brain Dorsolateral Prefrontal Cortex brain
15 chr1:150524000-150527800 Weak transcription Brain Cingulate Gyrus brain
16 chr1:150524000-150532600 Weak transcription Primary T cells from cord blood blood
17 chr1:150524200-150526600 Enhancers Colon Smooth Muscle Colon
18 chr1:150524200-150527200 Transcr. at gene 5' and 3' Foreskin Fibroblast Primary Cells skin02 Skin
19 chr1:150524400-150527200 Genic enhancers Fetal Muscle Leg muscle
20 chr1:150524600-150526400 Enhancers hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
21 chr1:150524600-150526400 Enhancers HMEC breast
22 chr1:150524600-150527200 Transcr. at gene 5' and 3' Foreskin Fibroblast Primary Cells skin01 Skin
23 chr1:150524600-150532000 Weak transcription Brain Inferior Temporal Lobe brain
24 chr1:150524600-150532600 Weak transcription iPS-18 Cell Line embryonic stem cell
25 chr1:150524600-150532600 Weak transcription Primary T killer memory cells from peripheral blood blood
26 chr1:150524800-150528000 Weak transcription Rectal Smooth Muscle rectum
27 chr1:150524800-150531800 Weak transcription hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
28 chr1:150524800-150532200 Weak transcription Primary T regulatory cells fromperipheralblood blood
29 chr1:150525000-150528000 Weak transcription H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
30 chr1:150525000-150531000 Weak transcription Foreskin Melanocyte Primary Cells skin03 Skin
31 chr1:150525200-150526400 Enhancers Adipose Nuclei Adipose
32 chr1:150525200-150526800 Weak transcription Fetal Brain Female brain
33 chr1:150525200-150527800 Weak transcription Gastric stomach
34 chr1:150525200-150528600 Weak transcription HUES48 Cell Line embryonic stem cell
35 chr1:150525200-150528800 Weak transcription HUES64 Cell Line embryonic stem cell
36 chr1:150525400-150526600 Enhancers Duodenum Smooth Muscle Duodenum
37 chr1:150525400-150527800 Weak transcription ES-UCSF4 Cell Line embryonic stem cell
38 chr1:150525400-150528000 Weak transcription H1 Cell Line embryonic stem cell
39 chr1:150525400-150528000 Weak transcription H9 Cell Line embryonic stem cell
40 chr1:150525400-150528000 Weak transcription iPS DF 6.9 Cell Line embryonic stem cell
41 chr1:150525400-150528000 Weak transcription Fetal Kidney kidney
42 chr1:150525400-150528200 Weak transcription iPS-15b Cell Line embryonic stem cell
43 chr1:150525400-150528200 Weak transcription Pancreas Pancrea
44 chr1:150525400-150528400 Weak transcription hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
45 chr1:150525400-150531200 Genic enhancers Placenta Placenta
46 chr1:150525400-150531600 Weak transcription Rectal Mucosa Donor 31 rectum
47 chr1:150525400-150532200 Weak transcription Primary T helper naive cells fromperipheralblood blood
48 chr1:150525400-150532200 Weak transcription Brain Anterior Caudate brain
49 chr1:150525400-150532600 Weak transcription H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
50 chr1:150525400-150532600 Weak transcription HUES6 Cell Line embryonic stem cell

Quick Search:


  
Input of quick search could be:

what's new

Quick links