Variant report

Variant	rs60728448
Chromosome Location	chr20:1114199-1114200
allele	-/GTGTATATATATATATATATAT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr20:1102460..1104842-chr20:1112243..1114796,2	K562	blood:

Extended variants
information (count: 29 )
Associated
traits (count: 0)

rSNPs within LD-proxies of this variant (count:16)

rs_ID	r²[population]
rs11087015	0.86[EUR][1000 genomes];1.00[ASN][1000 genomes]
rs11697070	0.80[AMR][1000 genomes]
rs11699188	0.80[AMR][1000 genomes];1.00[ASN][1000 genomes]
rs11699981	0.82[ASN][1000 genomes]
rs3787573	1.00[ASN][1000 genomes]
rs45443791	0.88[ASN][1000 genomes]
rs4553882	0.80[AMR][1000 genomes];1.00[ASN][1000 genomes]
rs6032895	1.00[ASN][1000 genomes]
rs6032947	0.82[ASN][1000 genomes]
rs6040044	0.80[AMR][1000 genomes];1.00[ASN][1000 genomes]
rs6040122	0.82[ASN][1000 genomes]
rs6514113	1.00[ASN][1000 genomes]
rs6514115	0.80[AMR][1000 genomes];0.82[ASN][1000 genomes]
rs73071630	1.00[ASN][1000 genomes]
rs7348188	0.97[ASN][1000 genomes]
rs8117499	0.80[AMR][1000 genomes];0.82[ASN][1000 genomes]

Variant overlapped rSNPs/rCNVs (count:13 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv531450	chr20:809607-1221836	Weak transcription ZNF genes & repeats Enhancers Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Strong transcription Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	23 gene(s)	inside rSNPs	diseases
2	nsv1058524	chr20:821434-1254865	Flanking Active TSS Enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh Genic enhancers Strong transcription Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	23 gene(s)	inside rSNPs	diseases
3	nsv544138	chr20:821434-1254865	Enhancers Strong transcription Weak transcription Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	23 gene(s)	inside rSNPs	diseases
4	nsv1057939	chr20:824980-1316778	Enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Active TSS Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	34 gene(s)	inside rSNPs	diseases
5	nsv1065838	chr20:866302-1147601	Genic enhancers Strong transcription Weak transcription Enhancers Bivalent Enhancer Active TSS Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
6	nsv544139	chr20:866302-1147601	Weak transcription Strong transcription Enhancers Flanking Active TSS Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
7	nsv1055328	chr20:867911-1145765	Genic enhancers Strong transcription Weak transcription Active TSS Bivalent/Poised TSS Flanking Active TSS Enhancers Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
8	nsv1059611	chr20:867911-1158694	Enhancers Strong transcription Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Active TSS Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	17 gene(s)	inside rSNPs	diseases
9	nsv544140	chr20:867911-1158694	Strong transcription Weak transcription Enhancers Genic enhancers Flanking Active TSS Bivalent/Poised TSS Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	17 gene(s)	inside rSNPs	diseases
10	nsv949356	chr20:961527-1135413	Flanking Bivalent TSS/Enh Weak transcription Enhancers Strong transcription Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
11	nsv912585	chr20:992713-1210647	Strong transcription Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
12	nsv1057097	chr20:1030940-1314265	Active TSS Flanking Bivalent TSS/Enh Strong transcription Flanking Active TSS Enhancers Weak transcription Genic enhancers Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	27 gene(s)	inside rSNPs	diseases
13	esv1799982	chr20:1097289-1136252	Flanking Active TSS Genic enhancers Strong transcription Weak transcription Active TSS Enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region	7 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:126 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr20:1100400-1115200	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
2	chr20:1100400-1132600	Weak transcription	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
3	chr20:1100400-1146600	Weak transcription	ES-WA7 Cell Line	embryonic stem cell
4	chr20:1100800-1122200	Strong transcription	HUES64 Cell Line	embryonic stem cell
5	chr20:1102200-1128600	Strong transcription	HUES48 Cell Line	embryonic stem cell
6	chr20:1103600-1127800	Weak transcription	Fetal Heart	heart
7	chr20:1103600-1130800	Strong transcription	Primary Natural Killer cells fromperipheralblood	blood
8	chr20:1103600-1130800	Strong transcription	Foreskin Keratinocyte Primary Cells skin03	Skin
9	chr20:1104200-1122400	Strong transcription	iPS-18 Cell Line	embryonic stem cell
10	chr20:1104200-1122600	Strong transcription	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
11	chr20:1104600-1115200	Strong transcription	Primary T cells fromperipheralblood	blood
12	chr20:1104600-1125600	Strong transcription	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
13	chr20:1104600-1128600	Strong transcription	Primary T regulatory cells fromperipheralblood	blood
14	chr20:1104600-1135800	Strong transcription	Dnd41	blood
15	chr20:1105200-1121600	Strong transcription	Foreskin Melanocyte Primary Cells skin03	Skin
16	chr20:1105400-1114200	Strong transcription	Brain Hippocampus Middle	brain
17	chr20:1105400-1122800	Strong transcription	Primary T helper cells PMA-I stimulated	--
18	chr20:1105600-1122800	Strong transcription	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
19	chr20:1105800-1114200	Strong transcription	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
20	chr20:1105800-1122400	Strong transcription	iPS-20b Cell Line	embryonic stem cell
21	chr20:1105800-1122600	Strong transcription	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
22	chr20:1106000-1114200	Strong transcription	Duodenum Smooth Muscle	Duodenum
23	chr20:1106200-1114200	Strong transcription	Fetal Lung	lung
24	chr20:1110400-1115200	Weak transcription	iPS-15b Cell Line	embryonic stem cell
25	chr20:1110800-1116600	Weak transcription	Fetal Brain Male	brain
26	chr20:1111000-1115400	Weak transcription	NH-A	brain
27	chr20:1111200-1115800	Weak transcription	NHDF-Ad	bronchial
28	chr20:1111600-1115200	Weak transcription	Rectal Smooth Muscle	rectum
29	chr20:1111600-1115200	Weak transcription	HUVEC	blood vessel
30	chr20:1111800-1114600	Weak transcription	NHLF	lung
31	chr20:1111800-1115200	Weak transcription	Colonic Mucosa	Colon
32	chr20:1112000-1114600	Weak transcription	Stomach Mucosa	stomach
33	chr20:1112000-1115200	Weak transcription	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
34	chr20:1112000-1115200	Weak transcription	Psoas Muscle	Psoas
35	chr20:1112000-1116000	Weak transcription	ES-I3 Cell Line	embryonic stem cell
36	chr20:1112200-1114200	Strong transcription	Primary T helper cells fromperipheralblood	blood
37	chr20:1112200-1115200	Weak transcription	Primary T helper naive cells from peripheral blood	blood
38	chr20:1112200-1115200	Weak transcription	Primary T killer memory cells from peripheral blood	blood
39	chr20:1112200-1137400	Strong transcription	Monocytes-CD14+_RO01746	blood
40	chr20:1112400-1114600	Weak transcription	NHEK	skin
41	chr20:1112400-1115000	Weak transcription	H1 Cell Line	embryonic stem cell
42	chr20:1112400-1115000	Weak transcription	Esophagus	oesophagus
43	chr20:1112400-1115000	Weak transcription	Skeletal Muscle Male	skeletal muscle
44	chr20:1112400-1115200	Weak transcription	H1 Derived Mesenchymal Stem Cells	ES cell derived
45	chr20:1112400-1115200	Weak transcription	H9 Cell Line	embryonic stem cell
46	chr20:1112400-1115200	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
47	chr20:1112400-1115800	Weak transcription	Primary T helper memory cells from peripheral blood 1	blood
48	chr20:1112400-1122400	Strong transcription	Primary B cells from cord blood	blood
49	chr20:1112400-1154800	Strong transcription	Primary monocytes fromperipheralblood	blood
50	chr20:1112600-1115000	Weak transcription	IMR90 fetal lung fibroblasts Cell Line	lung

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links