Variant report

Variant	rs67682090
Chromosome Location	chr5:115730513-115730514
allele	-/CCTACAAAACTACTGTAGTTTTT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 4 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:4 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv2755349	chr5:115384101-115733101	Active TSS Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Strong transcription Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
2	esv2763489	chr5:115693166-115733327	ZNF genes & repeats Weak transcription Enhancers Strong transcription Active TSS Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Genic enhancers	Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
3	nsv522616	chr5:115725791-115744515	Enhancers Weak transcription Strong transcription Flanking Active TSS Genic enhancers ZNF genes & repeats	Chromatin interactive region lncRNA	n/a	inside rSNPs	diseases
4	esv1845769	chr5:115730278-115763979	Enhancers Weak transcription Strong transcription Genic enhancers Flanking Active TSS ZNF genes & repeats	Chromatin interactive region lncRNA	n/a	inside rSNPs	diseases

No data

Chromatin state (count:31 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:115697600-115748400	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
2	chr5:115707600-115748400	Weak transcription	Fetal Intestine Large	intestine
3	chr5:115708600-115754000	Weak transcription	Sigmoid Colon	Sigmoid Colon
4	chr5:115711800-115730600	Weak transcription	Gastric	stomach
5	chr5:115718400-115737000	Weak transcription	Primary B cells from cord blood	blood
6	chr5:115718600-115748400	Weak transcription	Primary T helper cells fromperipheralblood	blood
7	chr5:115718800-115731000	Weak transcription	Spleen	Spleen
8	chr5:115719400-115734800	Weak transcription	Primary T cells from cord blood	blood
9	chr5:115723000-115776000	Weak transcription	Primary hematopoietic stem cells	blood
10	chr5:115723600-115784800	Weak transcription	Primary T helper naive cells fromperipheralblood	blood
11	chr5:115724800-115745600	Weak transcription	H1 Derived Mesenchymal Stem Cells	ES cell derived
12	chr5:115724800-115749200	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
13	chr5:115726200-115731600	Weak transcription	Aorta	Aorta
14	chr5:115728400-115730800	Weak transcription	Fetal Intestine Small	intestine
15	chr5:115729400-115733200	Enhancers	Psoas Muscle	Psoas
16	chr5:115729400-115733200	Enhancers	Skeletal Muscle Male	skeletal muscle
17	chr5:115729400-115733200	Enhancers	Skeletal Muscle Female	skeletal muscle
18	chr5:115730000-115731000	Weak transcription	ES-I3 Cell Line	embryonic stem cell
19	chr5:115730000-115732800	Enhancers	Rectal Smooth Muscle	rectum
20	chr5:115730200-115730800	Enhancers	Stomach Smooth Muscle	stomach
21	chr5:115730200-115731600	Enhancers	Fetal Muscle Trunk	muscle
22	chr5:115730200-115731800	Enhancers	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
23	chr5:115730200-115732600	Enhancers	Esophagus	oesophagus
24	chr5:115730200-115732600	Enhancers	Fetal Adrenal Gland	Adrenal Gland
25	chr5:115730200-115732800	Enhancers	Fetal Muscle Leg	muscle
26	chr5:115730200-115732800	Enhancers	Left Ventricle	heart
27	chr5:115730200-115733000	Enhancers	Right Ventricle	heart
28	chr5:115730400-115731800	Enhancers	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
29	chr5:115730400-115732400	Enhancers	Fetal Kidney	kidney
30	chr5:115730400-115733000	Enhancers	Colon Smooth Muscle	Colon
31	chr5:115730400-115769600	Weak transcription	Primary T cells effector/memory enriched fromperipheralblood	blood

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links