Variant report

Variant	rs72214730
Chromosome Location	chr6:33479811-33479812
allele	-/CGCGCCACTGGAGGCTGAGGC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr6:33422288..33424743-chr6:33478570..33480571,2	MCF-7	breast:
2	chr6:33393869..33396201-chr6:33479107..33481448,2	MCF-7	breast:
3	chr6:33479121..33484420-chr6:33487848..33490096,5	K562	blood:

Variant related genes	Relation type
ENSG00000213588	Chromatin interaction

Extended variants
information (count: 5 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:5 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv830637	chr6:33329365-33510704	Flanking Active TSS Weak transcription Strong transcription Active TSS Enhancers Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	62 gene(s)	inside rSNPs	diseases
2	nsv602832	chr6:33382241-33520221	Weak transcription Active TSS Strong transcription Enhancers Flanking Active TSS Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	41 gene(s)	inside rSNPs	diseases
3	nsv521506	chr6:33468151-33480738	Weak transcription Active TSS Flanking Active TSS Enhancers Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers ZNF genes & repeats	Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
4	nsv524010	chr6:33468151-33505981	Flanking Active TSS Bivalent/Poised TSS Weak transcription Flanking Bivalent TSS/Enh Enhancers Active TSS Bivalent Enhancer ZNF genes & repeats Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region	5 gene(s)	inside rSNPs	diseases
5	esv3392894	chr6:33479074-33482772	Active TSS Weak transcription Bivalent Enhancer Enhancers Strong transcription Bivalent/Poised TSS Flanking Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:22 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr6:33474400-33481200	Weak transcription	Fetal Intestine Small	intestine
2	chr6:33477200-33480400	Weak transcription	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
3	chr6:33477400-33480000	Weak transcription	Primary B cells from cord blood	blood
4	chr6:33477400-33480200	Weak transcription	Right Atrium	heart
5	chr6:33477600-33480000	Weak transcription	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
6	chr6:33477600-33480000	Weak transcription	HUES48 Cell Line	embryonic stem cell
7	chr6:33477600-33480000	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell
8	chr6:33477600-33480000	Weak transcription	Spleen	Spleen
9	chr6:33477600-33480200	Weak transcription	HUES6 Cell Line	embryonic stem cell
10	chr6:33477600-33480200	Weak transcription	iPS-18 Cell Line	embryonic stem cell
11	chr6:33477800-33480600	Weak transcription	GM12878-XiMat	blood
12	chr6:33479400-33480200	Enhancers	K562	blood
13	chr6:33479400-33480600	Enhancers	Primary Natural Killer cells fromperipheralblood	blood
14	chr6:33479800-33480400	Flanking Active TSS	Primary neutrophils fromperipheralblood	blood
15	chr6:33479800-33480400	Flanking Active TSS	Monocytes-CD14+_RO01746	blood
16	chr6:33479800-33480600	Enhancers	H1 Cell Line	embryonic stem cell
17	chr6:33479800-33480600	Enhancers	ES-UCSF4 Cell Line	embryonic stem cell
18	chr6:33479800-33480600	Enhancers	Primary monocytes fromperipheralblood	blood
19	chr6:33479800-33480600	Bivalent Enhancer	Primary T cells fromperipheralblood	blood
20	chr6:33479800-33480600	Enhancers	Placenta	Placenta
21	chr6:33479800-33481000	Enhancers	Primary T helper 17 cells PMA-I stimulated	--
22	chr6:33479800-33481200	Enhancers	Fetal Thymus	thymus

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links