Variant report

Variant rs137853929
Chromosome Location chr19:18717414-18717415
allele -/CAATCCGCGCGGCGGCCGCCGCC
Outlinks Ensembl   UCSC
Chromatin state (count:45 , 50 per page) page: 1
No. Chromosome Location Chromatin state Cell line Tissue
1 chr19:18714000-18718200 Active TSS Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
2 chr19:18714400-18717600 Bivalent Enhancer Cortex derived primary cultured neurospheres brain
3 chr19:18714400-18718400 Active TSS HSMMtube muscle
4 chr19:18714400-18719000 Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
5 chr19:18715000-18718200 Bivalent Enhancer ES-UCSF4 Cell Line embryonic stem cell
6 chr19:18715400-18718200 Bivalent Enhancer Primary T helper cells fromperipheralblood blood
7 chr19:18715400-18719000 Active TSS HSMM muscle
8 chr19:18716000-18718800 Bivalent/Poised TSS Osteobl bone
9 chr19:18716200-18718800 Bivalent/Poised TSS H9 Cell Line embryonic stem cell
10 chr19:18716200-18718800 Bivalent Enhancer Colonic Mucosa Colon
11 chr19:18716200-18719000 Bivalent Enhancer Primary T helper memory cells from peripheral blood 1 blood
12 chr19:18716400-18718000 Bivalent Enhancer Primary hematopoietic stem cells G-CSF-mobilized Female --
13 chr19:18716400-18718200 Bivalent/Poised TSS Left Ventricle heart
14 chr19:18716400-18718600 Bivalent/Poised TSS Psoas Muscle Psoas
15 chr19:18716600-18718200 Bivalent/Poised TSS HUES6 Cell Line embryonic stem cell
16 chr19:18716600-18718200 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
17 chr19:18716600-18718200 Active TSS Right Ventricle heart
18 chr19:18716600-18718600 Enhancers Primary T helper naive cells fromperipheralblood blood
19 chr19:18716600-18718800 Bivalent/Poised TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
20 chr19:18716600-18719200 Bivalent Enhancer Fetal Adrenal Gland Adrenal Gland
21 chr19:18716800-18717800 Bivalent Enhancer Fetal Stomach stomach
22 chr19:18716800-18718600 Enhancers Primary B cells from cord blood blood
23 chr19:18716800-18719000 Enhancers Pancreas Pancrea
24 chr19:18717000-18717600 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
25 chr19:18717000-18718000 Bivalent Enhancer Brain Germinal Matrix brain
26 chr19:18717000-18718400 Bivalent/Poised TSS HUES48 Cell Line embryonic stem cell
27 chr19:18717000-18718600 Bivalent/Poised TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
28 chr19:18717200-18717600 Bivalent Enhancer Foreskin Fibroblast Primary Cells skin02 Skin
29 chr19:18717200-18717600 Bivalent/Poised TSS Thymus Thymus
30 chr19:18717200-18717800 Bivalent/Poised TSS H1 Cell Line embryonic stem cell
31 chr19:18717200-18717800 Bivalent/Poised TSS IMR90 fetal lung fibroblasts Cell Line lung
32 chr19:18717200-18717800 Active TSS Breast Myoepithelial Primary Cells Breast
33 chr19:18717200-18717800 Bivalent Enhancer Primary T regulatory cells fromperipheralblood blood
34 chr19:18717200-18717800 Active TSS Pancreatic Islets Pancreatic Islet
35 chr19:18717200-18718000 Bivalent/Poised TSS iPS DF 6.9 Cell Line embryonic stem cell
36 chr19:18717200-18718000 Bivalent/Poised TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
37 chr19:18717200-18718200 Active TSS Muscle Satellite Cultured Cells --
38 chr19:18717200-18718200 Active TSS HMEC breast
39 chr19:18717200-18718800 Active TSS Right Atrium heart
40 chr19:18717200-18718800 Active TSS HepG2 liver
41 chr19:18717400-18717800 Bivalent/Poised TSS Ganglion Eminence derived primary cultured neurospheres brain
42 chr19:18717400-18717800 Bivalent Enhancer Foreskin Fibroblast Primary Cells skin01 Skin
43 chr19:18717400-18717800 Bivalent Enhancer Foreskin Keratinocyte Primary Cells skin03 Skin
44 chr19:18717400-18717800 Bivalent Enhancer Foreskin Melanocyte Primary Cells skin03 Skin
45 chr19:18717400-18717800 Bivalent/Poised TSS Ovary ovary

Quick Search:


  
Input of quick search could be:

what's new

Quick links