Variant report

Variant	rs143207501
Chromosome Location	chr16:33939332-33939333
allele	-/GGTCCAGTCAGGAGTCCGACCC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	BRCA1	chr16:33939298-33939579	GM12878	blood:	n/a	n/a
2	HMGN3	chr16:33938882-33939396	K562	blood:	n/a	n/a
3	RCOR1	chr16:33938937-33939650	Hela-S3	cervix:	n/a	n/a
4	USF2	chr16:33938892-33939534	HepG2	liver:	n/a	n/a
5	NRF1	chr16:33939023-33939490	GM12878	blood:	n/a	n/a
6	RFX5	chr16:33939158-33939485	HepG2	liver:	n/a	n/a
7	CTCF	chr16:33939300-33939450	HPF	lung:	n/a	n/a
8	CHD2	chr16:33938966-33939544	K562	blood:	n/a	n/a
9	MAZ	chr16:33939039-33939590	Hela-S3	cervix:	n/a	n/a
10	CHD2	chr16:33938892-33939416	HepG2	liver:	n/a	n/a
11	ZNF274	chr16:33938961-33939635	Hela-S3	cervix:	n/a	n/a
12	CHD2	chr16:33938340-33939628	GM12878	blood:	n/a	chr16:33938459-33938469
13	RCOR1	chr16:33938632-33939485	HepG2	liver:	n/a	n/a
14	CTCF	chr16:33939260-33939410	HFF-Myc	foreskin:	n/a	n/a
15	WRNIP1	chr16:33939141-33939691	GM12878	blood:	n/a	n/a
16	TCF7L2	chr16:33938787-33939813	Hela-S3	cervix:	n/a	n/a
17	ELF1	chr16:33937538-33939860	GM12878	blood:	n/a	n/a
18	CTCF	chr16:33939220-33939370	HFF-Myc	foreskin:	n/a	n/a

Variant related genes	Relation type
ENSG00000261440	TF binding region
PCMTD1P2	TF binding region

Extended variants
information (count: 63 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:63 , 50 per page) page: 1 2

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1066297	chr16:33054646-34011271	Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Weak transcription Active TSS Bivalent Enhancer Enhancers Flanking Active TSS Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	70 gene(s)	inside rSNPs	diseases
2	nsv1063683	chr16:33338112-34011271	ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Enhancers Active TSS Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	54 gene(s)	inside rSNPs	diseases
3	nsv906567	chr16:33460718-33944268	ZNF genes & repeats Weak transcription Active TSS Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Enhancers Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	27 gene(s)	inside rSNPs	diseases
4	nsv1056975	chr16:33526608-34011271	Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
5	nsv433445	chr16:33556312-33959923	ZNF genes & repeats Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Enhancers Bivalent Enhancer Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	37 gene(s)	inside rSNPs	diseases
6	nsv1066871	chr16:33603125-34011271	ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Weak transcription Bivalent Enhancer Flanking Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	43 gene(s)	inside rSNPs	diseases
7	nsv1063500	chr16:33627814-34011271	Bivalent/Poised TSS ZNF genes & repeats Active TSS Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	41 gene(s)	inside rSNPs	diseases
8	nsv1061765	chr16:33665155-34011271	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Bivalent Enhancer Enhancers Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	37 gene(s)	inside rSNPs	diseases
9	esv1823144	chr16:33673394-34211708	ZNF genes & repeats Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	37 gene(s)	inside rSNPs	diseases
10	nsv1066325	chr16:33754979-34011271	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Enhancers Bivalent/Poised TSS Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	32 gene(s)	inside rSNPs	diseases
11	nsv906603	chr16:33769308-34176875	Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh Weak transcription Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
12	esv1798568	chr16:33773021-33940418	ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Bivalent Enhancer Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
13	nsv1062253	chr16:33773053-33963957	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Bivalent Enhancer Flanking Active TSS Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	28 gene(s)	inside rSNPs	diseases
14	nsv1057370	chr16:33773053-34011271	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Enhancers Bivalent Enhancer Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
15	nsv572296	chr16:33795687-34004547	ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Enhancers Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	27 gene(s)	inside rSNPs	diseases
16	nsv984324	chr16:33806463-33966478	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Active TSS Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
17	nsv1059491	chr16:33811489-33978846	ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Weak transcription Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
18	nsv1055536	chr16:33811489-34011271	Bivalent Enhancer ZNF genes & repeats Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
19	nsv1064122	chr16:33827050-33940200	Weak transcription ZNF genes & repeats Bivalent/Poised TSS Active TSS Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
20	nsv1058975	chr16:33827050-33978846	ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
21	nsv1065867	chr16:33827050-34011271	Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent Enhancer Weak transcription Bivalent/Poised TSS Enhancers Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
22	nsv572298	chr16:33827393-34020957	Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Bivalent Enhancer Bivalent/Poised TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
23	nsv572299	chr16:33827393-34196681	Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
24	nsv1060685	chr16:33828054-34011271	Flanking Bivalent TSS/Enh ZNF genes & repeats Weak transcription Bivalent Enhancer Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
25	nsv1056197	chr16:33828713-34011271	Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent Enhancer Active TSS Bivalent/Poised TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
26	nsv906622	chr16:33836510-34176875	ZNF genes & repeats Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
27	nsv1062549	chr16:33836789-34011271	Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Flanking Active TSS Enhancers Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
28	nsv1061646	chr16:33837886-34011271	ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Enhancers Bivalent/Poised TSS Bivalent Enhancer Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
29	nsv572305	chr16:33845195-34020957	Bivalent/Poised TSS ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
30	nsv572306	chr16:33845195-34196681	Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Bivalent/Poised TSS Flanking Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
31	nsv962141	chr16:33864394-33948518	ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Active TSS Enhancers Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
32	esv1801563	chr16:33864739-34183982	ZNF genes & repeats Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
33	esv1796282	chr16:33864739-34196681	Weak transcription ZNF genes & repeats Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
34	nsv572324	chr16:33870629-33944268	ZNF genes & repeats Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Enhancers Active TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
35	nsv906639	chr16:33870629-33944268	Weak transcription ZNF genes & repeats Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
36	nsv572328	chr16:33870994-34020957	Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Bivalent Enhancer Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
37	nsv572331	chr16:33872091-34020957	Weak transcription Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Flanking Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
38	esv1842708	chr16:33872091-34196681	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Active TSS Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
39	nsv572349	chr16:33894640-33944268	Bivalent/Poised TSS ZNF genes & repeats Weak transcription Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
40	nsv572352	chr16:33897978-34020957	ZNF genes & repeats Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
41	esv3333468	chr16:33902508-33992414	ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Weak transcription Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
42	nsv833208	chr16:33903020-34020334	ZNF genes & repeats Bivalent/Poised TSS Weak transcription Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
43	esv3361634	chr16:33913301-33973683	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
44	esv3409079	chr16:33917016-33973656	ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
45	esv3409997	chr16:33917580-33973683	ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Bivalent Enhancer Active TSS Flanking Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
46	esv3377462	chr16:33917600-33973653	ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Active TSS Flanking Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
47	esv3367843	chr16:33917604-33973657	ZNF genes & repeats Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
48	esv3426172	chr16:33917735-34021567	Flanking Bivalent TSS/Enh ZNF genes & repeats Weak transcription Bivalent Enhancer Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
49	esv3326188	chr16:33917735-34022251	ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Active TSS Enhancers Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
50	esv3379002	chr16:33918441-33973683	Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS Enhancers	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:47 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr16:33932000-33941200	ZNF genes & repeats	ES-UCSF4 Cell Line	embryonic stem cell
2	chr16:33932200-33957000	ZNF genes & repeats	HUES48 Cell Line	embryonic stem cell
3	chr16:33932200-33957200	ZNF genes & repeats	HUES6 Cell Line	embryonic stem cell
4	chr16:33932400-33951600	ZNF genes & repeats	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
5	chr16:33932400-33957000	ZNF genes & repeats	HUES64 Cell Line	embryonic stem cell
6	chr16:33932400-33957000	ZNF genes & repeats	iPS-20b Cell Line	embryonic stem cell
7	chr16:33932400-33961800	ZNF genes & repeats	iPS-18 Cell Line	embryonic stem cell
8	chr16:33932800-33966600	ZNF genes & repeats	Monocytes-CD14+_RO01746	blood
9	chr16:33933000-33941000	ZNF genes & repeats	Fetal Brain Male	brain
10	chr16:33933000-33961600	ZNF genes & repeats	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
11	chr16:33933200-33940800	ZNF genes & repeats	Duodenum Mucosa	Duodenum
12	chr16:33933800-33941200	ZNF genes & repeats	iPS-15b Cell Line	embryonic stem cell
13	chr16:33934200-33939600	ZNF genes & repeats	Liver	Liver
14	chr16:33934200-33939800	ZNF genes & repeats	H1 Cell Line	embryonic stem cell
15	chr16:33934200-33939800	ZNF genes & repeats	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
16	chr16:33934400-33939400	ZNF genes & repeats	Thymus	Thymus
17	chr16:33934800-33939600	ZNF genes & repeats	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
18	chr16:33935000-33939600	ZNF genes & repeats	Right Ventricle	heart
19	chr16:33935000-33939800	ZNF genes & repeats	Esophagus	oesophagus
20	chr16:33935000-33939800	ZNF genes & repeats	HepG2	liver
21	chr16:33935000-33940000	ZNF genes & repeats	Fetal Muscle Trunk	muscle
22	chr16:33935200-33939400	ZNF genes & repeats	Breast Myoepithelial Primary Cells	Breast
23	chr16:33935200-33939600	ZNF genes & repeats	iPS DF 6.9 Cell Line	embryonic stem cell
24	chr16:33935200-33939600	ZNF genes & repeats	Primary hematopoietic stem cells short term culture	blood
25	chr16:33935200-33939600	ZNF genes & repeats	Adipose Nuclei	Adipose
26	chr16:33935200-33939800	ZNF genes & repeats	Gastric	stomach
27	chr16:33935200-33939800	ZNF genes & repeats	Lung	lung
28	chr16:33935200-33939800	ZNF genes & repeats	Spleen	Spleen
29	chr16:33935200-33939800	ZNF genes & repeats	NHEK	skin
30	chr16:33935400-33939400	ZNF genes & repeats	IMR90 fetal lung fibroblasts Cell Line	lung
31	chr16:33935400-33939400	ZNF genes & repeats	Rectal Smooth Muscle	rectum
32	chr16:33935400-33939400	ZNF genes & repeats	Hela-S3	cervix
33	chr16:33935400-33939600	ZNF genes & repeats	Pancreas	Pancrea
34	chr16:33935400-33939600	ZNF genes & repeats	Skeletal Muscle Male	skeletal muscle
35	chr16:33935400-33939800	ZNF genes & repeats	H1 Derived Mesenchymal Stem Cells	ES cell derived
36	chr16:33935400-33940000	ZNF genes & repeats	Primary hematopoietic stem cells G-CSF-mobilized Male	--
37	chr16:33935600-33939600	ZNF genes & repeats	Cortex derived primary cultured neurospheres	brain
38	chr16:33935600-33940000	ZNF genes & repeats	Foreskin Keratinocyte Primary Cells skin03	Skin
39	chr16:33936600-33939400	ZNF genes & repeats	Rectal Mucosa Donor 31	rectum
40	chr16:33936600-33939600	ZNF genes & repeats	Colonic Mucosa	Colon
41	chr16:33937400-33940000	Weak transcription	Fetal Heart	heart
42	chr16:33937800-33939600	ZNF genes & repeats	Brain Hippocampus Middle	brain
43	chr16:33938200-33939400	ZNF genes & repeats	Primary mononuclear cells fromperipheralblood	Blood
44	chr16:33938200-33939800	ZNF genes & repeats	Foreskin Melanocyte Primary Cells skin03	Skin
45	chr16:33938200-33941400	ZNF genes & repeats	Primary T cells from cord blood	blood
46	chr16:33938400-33939600	Flanking Bivalent TSS/Enh	iPS DF 19.11 Cell Line	embryonic stem cell
47	chr16:33938800-33941000	ZNF genes & repeats	Pancreatic Islets	Pancreatic Islet

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links