Variant report

Variant rs143890393
Chromosome Location chr19:18391066-18391067
allele -/CGAGTCCGGGGCGCCCCTTC
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr19:18388800-18391600 Transcr. at gene 5' and 3' H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
2 chr19:18388800-18391600 Transcr. at gene 5' and 3' Primary T regulatory cells fromperipheralblood blood
3 chr19:18389000-18391600 Transcr. at gene 5' and 3' Primary T helper 17 cells PMA-I stimulated --
4 chr19:18389000-18391600 Transcr. at gene 5' and 3' Fetal Intestine Small intestine
5 chr19:18389000-18391600 Transcr. at gene 5' and 3' Dnd41 blood
6 chr19:18389000-18392000 Transcr. at gene 5' and 3' Skeletal Muscle Male skeletal muscle
7 chr19:18389000-18392200 Transcr. at gene 5' and 3' Primary T helper naive cells fromperipheralblood blood
8 chr19:18389000-18392200 Transcr. at gene 5' and 3' Pancreatic Islets Pancreatic Islet
9 chr19:18389600-18392400 Active TSS HSMMtube muscle
10 chr19:18389800-18393200 Active TSS Aorta Aorta
11 chr19:18389800-18393200 Active TSS Small Intestine intestine
12 chr19:18389800-18393600 Active TSS Ovary ovary
13 chr19:18389800-18393800 Active TSS H9 Cell Line embryonic stem cell
14 chr19:18390000-18391200 Active TSS iPS DF 19.11 Cell Line embryonic stem cell
15 chr19:18390000-18391200 Active TSS Foreskin Melanocyte Primary Cells skin01 Skin
16 chr19:18390000-18391400 Active TSS ES-WA7 Cell Line embryonic stem cell
17 chr19:18390000-18392200 Active TSS Placenta Amnion Placenta Amnion
18 chr19:18390000-18392400 Active TSS Gastric stomach
19 chr19:18390000-18393000 Active TSS H1 Derived Mesenchymal Stem Cells ES cell derived
20 chr19:18390000-18393200 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
21 chr19:18390000-18393200 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
22 chr19:18390000-18393400 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
23 chr19:18390000-18393600 Active TSS Esophagus oesophagus
24 chr19:18390000-18393800 Active TSS HUES48 Cell Line embryonic stem cell
25 chr19:18390000-18394000 Active TSS iPS-15b Cell Line embryonic stem cell
26 chr19:18390200-18391200 Active TSS Primary hematopoietic stem cells G-CSF-mobilized Male --
27 chr19:18390200-18391200 Active TSS Foreskin Fibroblast Primary Cells skin02 Skin
28 chr19:18390200-18392000 Active TSS Right Atrium heart
29 chr19:18390200-18392200 Active TSS Fetal Kidney kidney
30 chr19:18390200-18392200 Active TSS Fetal Lung lung
31 chr19:18390200-18392200 Active TSS Stomach Mucosa stomach
32 chr19:18390200-18392400 Active TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
33 chr19:18390200-18392400 Active TSS NH-A brain
34 chr19:18390200-18392400 Active TSS NHLF lung
35 chr19:18390200-18393000 Active TSS H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
36 chr19:18390200-18393000 Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
37 chr19:18390200-18393000 Active TSS ES-UCSF4 Cell Line embryonic stem cell
38 chr19:18390200-18393000 Active TSS Primary T cells effector/memory enriched fromperipheralblood blood
39 chr19:18390200-18393000 Active TSS Muscle Satellite Cultured Cells --
40 chr19:18390200-18393000 Active TSS Cortex derived primary cultured neurospheres brain
41 chr19:18390200-18393000 Active TSS Foreskin Keratinocyte Primary Cells skin02 Skin
42 chr19:18390200-18393000 Active TSS Brain Dorsolateral Prefrontal Cortex brain
43 chr19:18390200-18393000 Active TSS Brain Substantia Nigra brain
44 chr19:18390200-18393000 Active TSS Colonic Mucosa Colon
45 chr19:18390200-18393000 Active TSS Thymus Thymus
46 chr19:18390200-18393000 Active TSS GM12878-XiMat blood
47 chr19:18390200-18393000 Active TSS Hela-S3 cervix
48 chr19:18390200-18393000 Active TSS HSMM muscle
49 chr19:18390200-18393000 Active TSS K562 blood
50 chr19:18390200-18393200 Active TSS H1 Cell Line embryonic stem cell

Quick Search:


  
Input of quick search could be:

what's new

Quick links