Variant report

Variant	rs148523044
Chromosome Location	chr6:32267826-32267827
allele	-/AACTTAGAAACAGGACTTGGAGGATG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type
1	chr6:32266172..32268310-chr6:32269017..32271310,2	MCF-7	breast:
2	chr6:32264476..32267942-chr6:32268038..32271496,3	K562	blood:
3	chr6:32260150..32262258-chr6:32267045..32269420,2	MCF-7	breast:

Extended variants
information (count: 43 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:43 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1017945	chr6:31609641-32481240	Genic enhancers Weak transcription Transcr. at gene 5' and 3' Enhancers Active TSS Flanking Active TSS Bivalent Enhancer Strong transcription ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	322 gene(s)	inside rSNPs	diseases
2	nsv601950	chr6:31785438-32492308	Enhancers Bivalent Enhancer Active TSS Weak transcription Strong transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	197 gene(s)	inside rSNPs	diseases
3	nsv601951	chr6:31785438-32496748	Enhancers Flanking Active TSS Strong transcription Weak transcription Bivalent Enhancer Active TSS Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	197 gene(s)	inside rSNPs	diseases
4	nsv601955	chr6:31785453-32484368	Genic enhancers Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Active TSS Flanking Active TSS Weak transcription Transcr. at gene 5' and 3' Strong transcription ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	196 gene(s)	inside rSNPs	diseases
5	nsv601956	chr6:31785453-32492308	Strong transcription Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	197 gene(s)	inside rSNPs	diseases
6	nsv601961	chr6:31868322-32484368	Enhancers Strong transcription Active TSS Transcr. at gene 5' and 3' Genic enhancers Weak transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	126 gene(s)	inside rSNPs	diseases
7	nsv601972	chr6:31947594-32484368	Enhancers Genic enhancers Strong transcription Flanking Active TSS Active TSS Weak transcription Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	91 gene(s)	inside rSNPs	diseases
8	nsv601975	chr6:31949352-32484368	Enhancers Bivalent Enhancer Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Genic enhancers Weak transcription Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
9	nsv601976	chr6:31949352-32508887	Weak transcription Active TSS Bivalent Enhancer Enhancers Genic enhancers Strong transcription Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	93 gene(s)	inside rSNPs	diseases
10	nsv601977	chr6:31949352-32651056	Bivalent Enhancer Flanking Active TSS Genic enhancers Enhancers Active TSS Weak transcription Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	100 gene(s)	inside rSNPs	diseases
11	nsv601980	chr6:31950266-32484368	Enhancers Weak transcription Genic enhancers Active TSS Strong transcription Flanking Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
12	nsv601982	chr6:31951207-32484368	Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Bivalent Enhancer Active TSS Weak transcription Genic enhancers Transcr. at gene 5' and 3' Enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
13	nsv601983	chr6:31951367-32484368	Enhancers Strong transcription Flanking Active TSS Weak transcription Genic enhancers Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
14	nsv601984	chr6:31951912-32484368	Enhancers Weak transcription Active TSS Flanking Active TSS Strong transcription Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
15	nsv601999	chr6:31952422-32484368	Enhancers Flanking Active TSS Bivalent Enhancer Weak transcription Strong transcription Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
16	nsv602000	chr6:31952422-32552416	Genic enhancers Flanking Bivalent TSS/Enh Active TSS Enhancers Weak transcription Bivalent/Poised TSS Flanking Active TSS Transcr. at gene 5' and 3' Strong transcription Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	96 gene(s)	inside rSNPs	diseases
17	nsv602015	chr6:31953467-32481507	Enhancers Weak transcription Transcr. at gene 5' and 3' Strong transcription Flanking Active TSS Bivalent Enhancer Genic enhancers Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
18	nsv602016	chr6:31953467-32484368	Weak transcription Active TSS Flanking Active TSS Enhancers Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
19	nsv602017	chr6:31953467-32505730	Strong transcription Active TSS Flanking Active TSS Weak transcription Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	93 gene(s)	inside rSNPs	diseases
20	nsv602018	chr6:31953467-32509985	Flanking Active TSS Weak transcription Enhancers Bivalent Enhancer Active TSS Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	93 gene(s)	inside rSNPs	diseases
21	nsv602019	chr6:31953467-32779803	Transcr. at gene 5' and 3' Active TSS Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	109 gene(s)	inside rSNPs	diseases
22	nsv602029	chr6:31955572-32484368	Active TSS Flanking Active TSS Enhancers Weak transcription Strong transcription Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
23	nsv602035	chr6:31959480-32484368	Bivalent Enhancer Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Weak transcription Strong transcription Transcr. at gene 5' and 3' Genic enhancers ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
24	nsv602036	chr6:31959878-32484368	Weak transcription Transcr. at gene 5' and 3' Genic enhancers Flanking Active TSS Enhancers Strong transcription Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
25	nsv602052	chr6:31972034-32481507	Flanking Active TSS Enhancers Active TSS Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription Weak transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	89 gene(s)	inside rSNPs	diseases
26	nsv602053	chr6:31972034-32484368	Active TSS Strong transcription Weak transcription Enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	89 gene(s)	inside rSNPs	diseases
27	nsv602054	chr6:31972034-32779803	Enhancers Active TSS Strong transcription Weak transcription Flanking Active TSS Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	108 gene(s)	inside rSNPs	diseases
28	nsv602086	chr6:31986320-32484368	Enhancers Active TSS Genic enhancers Weak transcription Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	84 gene(s)	inside rSNPs	diseases
29	nsv1024599	chr6:32007556-32481240	Weak transcription Flanking Active TSS Active TSS Enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Strong transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	82 gene(s)	inside rSNPs	diseases
30	nsv884716	chr6:32223258-32278670	Enhancers Active TSS Flanking Active TSS Bivalent Enhancer Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
31	nsv884717	chr6:32224388-32286761	Enhancers Weak transcription Strong transcription ZNF genes & repeats Flanking Active TSS Active TSS Bivalent Enhancer	Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
32	nsv884718	chr6:32230678-32277153	Enhancers Active TSS Weak transcription Bivalent Enhancer ZNF genes & repeats Strong transcription Flanking Active TSS	Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
33	nsv884719	chr6:32230678-32281784	Enhancers ZNF genes & repeats Weak transcription Flanking Active TSS Bivalent Enhancer Active TSS Strong transcription	Chromatin interactive region lncRNA	1 gene(s)	inside rSNPs	diseases
34	nsv432878	chr6:32236121-32399021	Bivalent/Poised TSS Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
35	nsv538193	chr6:32245580-32297529	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
36	nsv884720	chr6:32261653-32271807	Enhancers Weak transcription Flanking Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
37	nsv884721	chr6:32261653-32273629	Enhancers Weak transcription Flanking Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
38	nsv884722	chr6:32261653-32278670	Enhancers Weak transcription Active TSS Flanking Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
39	nsv884723	chr6:32261653-32279340	Weak transcription Enhancers Flanking Active TSS Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
40	nsv884724	chr6:32261653-32279902	Enhancers Weak transcription Active TSS Flanking Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
41	nsv884725	chr6:32264825-32278670	Enhancers Weak transcription Active TSS Flanking Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
42	nsv884726	chr6:32264825-32279340	Enhancers Active TSS Weak transcription Flanking Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
43	nsv884727	chr6:32266535-32279340	Enhancers Weak transcription Flanking Active TSS Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases

No data

Chromatin state (count:2 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr6:32263800-32273400	Weak transcription	Ovary	ovary
2	chr6:32267200-32271600	Weak transcription	HUVEC	blood vessel

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links