Variant report

Variant	rs1799745
Chromosome Location	chr4:3533901-3533902
allele	-/CGGTCGGTGGAGCGGGGCCTG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	YY1	chr4:3533883-3534411	HCT-116	colon:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534331-3534340 chr4:3534199-3534208
2	YY1	chr4:3533807-3534428	SK-N-SH	brain:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534331-3534340 chr4:3534199-3534208
3	PML	chr4:3533877-3534239	K562	blood:	n/a	n/a
4	POLR2A	chr4:3533831-3534508	SK-N-SH	brain:	n/a	n/a
5	POLR2A	chr4:3533802-3534387	PFSK-1	brain:	n/a	n/a
6	TCF3	chr4:3533826-3534292	GM12878	blood:	n/a	n/a
7	RUNX3	chr4:3533757-3534422	GM12878	blood:	n/a	n/a
8	CHD2	chr4:3533878-3534422	Hela-S3	cervix:	n/a	n/a
9	POLR2A	chr4:3533864-3534277	K562	blood:	n/a	n/a
10	E2F6	chr4:3533512-3535019	H1-hESC	embryonic stem cell:	n/a	chr4:3534894-3534901 chr4:3534777-3534794 chr4:3534894-3534901 chr4:3534890-3534902 chr4:3534301-3534310 chr4:3534199-3534208 chr4:3534894-3534901 chr4:3534180-3534195
11	POLR2A	chr4:3533879-3534225	A549	lung:	n/a	n/a
12	ZBTB7A	chr4:3533542-3534129	ECC-1	luminal epithelium:	n/a	n/a
13	CCNT2	chr4:3533326-3534821	K562	blood:	n/a	chr4:3534199-3534208
14	CEBPD	chr4:3533804-3534326	HepG2	liver:	n/a	n/a
15	POLR2A	chr4:3533554-3534275	GM12878	blood:	n/a	n/a
16	HCFC1	chr4:3533348-3534677	Hela-S3	cervix:	n/a	n/a
17	MTA3	chr4:3533782-3534236	GM12878	blood:	n/a	n/a
18	MYBL2	chr4:3533863-3534238	HepG2	liver:	n/a	n/a
19	POLR2A	chr4:3533851-3534355	HCT-116	colon:	n/a	n/a
20	ELF1	chr4:3533858-3534446	GM12878	blood:	n/a	chr4:3534253-3534262 chr4:3534416-3534428
21	YY1	chr4:3533821-3534363	SK-N-SH_RA	brain:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534331-3534340 chr4:3534199-3534208
22	TAF1	chr4:3533880-3534317	GM12878	blood:	n/a	n/a
23	POLR2A	chr4:3533652-3534314	K562	blood:	n/a	n/a
24	POLR2A	chr4:3533823-3534265	U87	brain:	n/a	n/a
25	POLR2A	chr4:3533709-3534481	MCF-7	breast:	n/a	n/a
26	SIN3AK20	chr4:3533148-3534599	MCF-7	breast:	n/a	n/a
27	POLR2A	chr4:3533707-3534400	HEK293	kidney:	n/a	n/a
28	MXI1	chr4:3533529-3534507	HepG2	liver:	n/a	chr4:3534315-3534330 chr4:3534313-3534328
29	TAF7	chr4:3533779-3534345	H1-hESC	embryonic stem cell:	n/a	n/a
30	POLR2A	chr4:3533887-3534316	GM12878	blood:	n/a	n/a
31	POLR2A	chr4:3533841-3534403	A549	lung:	n/a	n/a
32	YY1	chr4:3533726-3534387	H1-hESC	embryonic stem cell:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534331-3534340 chr4:3534199-3534208
33	POLR2A	chr4:3533836-3534262	Hela-S3	cervix:	n/a	n/a
34	MXI1	chr4:3532648-3534748	SK-N-SH	brain:	n/a	chr4:3534315-3534330 chr4:3534313-3534328
35	YY1	chr4:3533666-3534450	GM12878	blood:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534331-3534340 chr4:3534199-3534208
36	YY1	chr4:3533900-3534295	GM12891	blood:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534199-3534208
37	POLR2A	chr4:3533852-3534291	K562	blood:	n/a	n/a
38	POLR2A	chr4:3533892-3534316	ECC-1	luminal epithelium:	n/a	n/a
39	MAX	chr4:3533472-3534424	NB4	blood:	n/a	chr4:3534186-3534196 chr4:3534200-3534210
40	POLR2A	chr4:3533803-3534302	GM12878	blood:	n/a	n/a
41	POLR2A	chr4:3533706-3534436	SK-N-MC	brain:	n/a	n/a
42	YY1	chr4:3533565-3534515	HepG2	liver:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534331-3534340 chr4:3533658-3533672 chr4:3534199-3534208
43	REST	chr4:3533895-3534214	PFSK-1	brain:	n/a	n/a
44	CREB1	chr4:3533827-3534423	GM12878	blood:	n/a	n/a
45	POLR2A	chr4:3533641-3534386	GM15510	blood:	n/a	n/a
46	TAF7	chr4:3533820-3534321	H1-hESC	embryonic stem cell:	n/a	n/a
47	POLR2A	chr4:3533891-3534399	HUVEC	blood vessel:	n/a	n/a
48	POLR2A	chr4:3533781-3534401	HL-60	blood:	n/a	n/a
49	YY1	chr4:3533537-3534398	SK-N-SH	brain:	n/a	chr4:3534262-3534276 chr4:3534131-3534143 chr4:3534331-3534340 chr4:3533658-3533672 chr4:3534199-3534208
50	POLR2A	chr4:3533835-3534445	PANC-1	pancreas:	n/a	n/a

No.	Distal block	Cell Line	Cell type
1	chr4:3484714..3487220-chr4:3532599..3535251,4	MCF-7	breast:
2	chr4:3533711..3534459-chr4:37827885..37828819,2	NB4	blood:
3	chr4:3505996..3508502-chr4:3532623..3535240,2	MCF-7	breast:
4	chr17:8076317..8077036-chr4:3533772..3534554,2	Hela-S3	cervix:
5	chr19:10443695..10444576-chr4:3533618..3534349,2	NB4	blood:
6	chr4:3316773..3319078-chr4:3532523..3535417,2	K562	blood:
7	chr17:57970401..57971032-chr4:3533463..3534157,2	MCF-7	breast:
8	chr4:3532933..3534970-chr4:3765784..3768236,2	MCF-7	breast:
9	chr4:3510589..3512915-chr4:3532511..3535420,4	K562	blood:
10	chr21:44846547..44847350-chr4:3533615..3534228,2	Hela-S3	cervix:
11	chr4:3485927..3488368-chr4:3533732..3536345,3	MCF-7	breast:
12	chr4:3532686..3534345-chr4:3544776..3546772,2	MCF-7	breast:
13	chr4:3510781..3520846-chr4:3531784..3535437,12	MCF-7	breast:
14	chr4:3464468..3466347-chr4:3532849..3534407,2	MCF-7	breast:

Variant related genes	Relation type
LRPAP1	TF binding region
ENSG00000261643	Chromatin interaction
ENSG00000184160	Chromatin interaction
ENSG00000169299	Chromatin interaction
ENSG00000161847	Chromatin interaction
ENSG00000159788	Chromatin interaction
ENSG00000268781	Chromatin interaction
ENSG00000108443	Chromatin interaction
ENSG00000175920	Chromatin interaction
ENSG00000200463	Chromatin interaction
ENSG00000142178	Chromatin interaction
ENSG00000270090	Chromatin interaction

Extended variants
information (count: 41 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:41 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv428106	chr4:3226182-3752322	Enhancers ZNF genes & repeats Weak transcription Strong transcription Active TSS Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	33 gene(s)	inside rSNPs	diseases
2	nsv428435	chr4:3386773-3623321	Enhancers Strong transcription Weak transcription Genic enhancers Active TSS Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
3	nsv933265	chr4:3392824-4283640	Enhancers Weak transcription Active TSS Strong transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	60 gene(s)	inside rSNPs	diseases
4	esv2757918	chr4:3394344-4350986	Enhancers Strong transcription Flanking Active TSS Active TSS Genic enhancers Weak transcription Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	64 gene(s)	inside rSNPs	diseases
5	esv2759219	chr4:3394344-4350986	Weak transcription Flanking Active TSS Strong transcription Enhancers Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	64 gene(s)	inside rSNPs	diseases
6	nsv878465	chr4:3405165-3566567	Strong transcription Flanking Active TSS Weak transcription Enhancers Active TSS Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
7	esv1791851	chr4:3407753-3534022	Bivalent Enhancer Enhancers Strong transcription Bivalent/Poised TSS Weak transcription Genic enhancers Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
8	nsv1000383	chr4:3412585-3839781	Flanking Active TSS Enhancers Weak transcription Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS Active TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
9	nsv878469	chr4:3413209-3566567	Weak transcription Genic enhancers Active TSS Enhancers Flanking Active TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
10	nsv878470	chr4:3413209-3566567	Weak transcription Strong transcription Bivalent Enhancer Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Active TSS Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
11	nsv878471	chr4:3413209-3884998	Bivalent Enhancer Enhancers Weak transcription Active TSS Strong transcription Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
12	esv1816543	chr4:3414654-3942867	Enhancers Bivalent Enhancer Bivalent/Poised TSS Weak transcription Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Flanking Active TSS Transcr. at gene 5' and 3' Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	35 gene(s)	inside rSNPs	diseases
13	nsv1001328	chr4:3421979-3654381	Bivalent/Poised TSS Enhancers Bivalent Enhancer Strong transcription Flanking Active TSS Active TSS ZNF genes & repeats Weak transcription Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
14	nsv967719	chr4:3429579-3535969	Genic enhancers Active TSS Weak transcription Enhancers Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
15	nsv470004	chr4:3429856-3584373	Bivalent Enhancer Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Strong transcription Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	23 gene(s)	inside rSNPs	diseases
16	nsv1011554	chr4:3436478-3975772	ZNF genes & repeats Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	38 gene(s)	inside rSNPs	diseases
17	nsv537002	chr4:3436478-3975772	Weak transcription Flanking Active TSS Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3' Active TSS Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	38 gene(s)	inside rSNPs	diseases
18	nsv878477	chr4:3438643-3584059	ZNF genes & repeats Enhancers Strong transcription Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Active TSS Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	23 gene(s)	inside rSNPs	diseases
19	nsv829840	chr4:3444216-3623031	Genic enhancers Enhancers Flanking Active TSS Bivalent Enhancer Weak transcription Strong transcription ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
20	nsv878478	chr4:3447243-3566567	Bivalent Enhancer Active TSS Genic enhancers Weak transcription Enhancers Flanking Active TSS ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
21	nsv1002774	chr4:3450810-3577017	Enhancers Weak transcription Active TSS Strong transcription Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	22 gene(s)	inside rSNPs	diseases
22	nsv1012371	chr4:3450810-3878976	Enhancers Flanking Active TSS Bivalent Enhancer Strong transcription Weak transcription Active TSS Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
23	nsv537003	chr4:3450810-3878976	Active TSS Bivalent Enhancer Enhancers Genic enhancers Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
24	nsv998670	chr4:3453787-3909535	Active TSS Bivalent Enhancer Strong transcription Flanking Active TSS Enhancers ZNF genes & repeats Weak transcription Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	33 gene(s)	inside rSNPs	diseases
25	nsv878481	chr4:3461900-3566567	Strong transcription Enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers Weak transcription Active TSS Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
26	nsv878482	chr4:3461900-3573260	Bivalent Enhancer Strong transcription Enhancers Weak transcription Flanking Active TSS Genic enhancers Bivalent/Poised TSS Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
27	nsv878483	chr4:3461900-3683269	Enhancers Weak transcription Bivalent Enhancer ZNF genes & repeats Active TSS Strong transcription Flanking Bivalent TSS/Enh Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
28	nsv1008394	chr4:3462618-3577017	Weak transcription Enhancers Strong transcription Bivalent Enhancer Flanking Active TSS Active TSS Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	22 gene(s)	inside rSNPs	diseases
29	nsv998512	chr4:3472878-3643547	Enhancers Bivalent Enhancer Active TSS Flanking Active TSS Weak transcription ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
30	nsv537004	chr4:3472878-3643547	Weak transcription Transcr. at gene 5' and 3' ZNF genes & repeats Enhancers Bivalent Enhancer Active TSS Strong transcription Flanking Bivalent TSS/Enh Flanking Active TSS Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	24 gene(s)	inside rSNPs	diseases
31	nsv878486	chr4:3473139-3573260	Bivalent Enhancer Enhancers Weak transcription Strong transcription Active TSS Genic enhancers Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	20 gene(s)	inside rSNPs	diseases
32	nsv10426	chr4:3479490-3567710	Strong transcription Flanking Active TSS Active TSS Weak transcription Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
33	nsv878489	chr4:3481126-3566567	Enhancers Flanking Active TSS Weak transcription Genic enhancers Active TSS Bivalent Enhancer Strong transcription ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	18 gene(s)	inside rSNPs	diseases
34	nsv878490	chr4:3485786-3566567	Weak transcription Active TSS Bivalent Enhancer Flanking Active TSS Enhancers Strong transcription Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
35	nsv432549	chr4:3487321-3975048	Weak transcription Strong transcription Bivalent Enhancer Enhancers Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	34 gene(s)	inside rSNPs	diseases
36	nsv878492	chr4:3494251-3536002	Weak transcription Active TSS ZNF genes & repeats Enhancers Genic enhancers Flanking Active TSS Strong transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	14 gene(s)	inside rSNPs	diseases
37	nsv878494	chr4:3494600-3566567	Enhancers Weak transcription Strong transcription Bivalent Enhancer Active TSS Genic enhancers Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
38	nsv878495	chr4:3496150-3536002	Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers Weak transcription Enhancers Bivalent Enhancer Bivalent/Poised TSS Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	14 gene(s)	inside rSNPs	diseases
39	nsv829841	chr4:3502418-3663419	Enhancers ZNF genes & repeats Strong transcription Flanking Active TSS Weak transcription Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
40	nsv1002558	chr4:3505290-3878976	Bivalent Enhancer Active TSS Enhancers Weak transcription ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
41	esv3358079	chr4:3532979-3535527	Active TSS Flanking Active TSS Enhancers Weak transcription Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region	12 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:126 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr4:3531200-3534000	Flanking Active TSS	Monocytes-CD14+_RO01746	blood
2	chr4:3532400-3534800	Active TSS	Pancreatic Islets	Pancreatic Islet
3	chr4:3532600-3534200	Active TSS	Fetal Kidney	kidney
4	chr4:3532600-3534400	Active TSS	Foreskin Melanocyte Primary Cells skin01	Skin
5	chr4:3532600-3534800	Flanking Active TSS	Primary mononuclear cells fromperipheralblood	Blood
6	chr4:3532800-3534600	Active TSS	ES-I3 Cell Line	embryonic stem cell
7	chr4:3532800-3534600	Active TSS	Fetal Intestine Large	intestine
8	chr4:3532800-3534800	Transcr. at gene 5' and 3'	iPS DF 19.11 Cell Line	embryonic stem cell
9	chr4:3532800-3534800	Flanking Active TSS	Primary hematopoietic stem cells G-CSF-mobilized Female	--
10	chr4:3532800-3535000	Bivalent/Poised TSS	HUES64 Cell Line	embryonic stem cell
11	chr4:3533000-3534400	Active TSS	Pancreas	Pancrea
12	chr4:3533000-3534400	Active TSS	GM12878-XiMat	blood
13	chr4:3533000-3534600	Active TSS	Gastric	stomach
14	chr4:3533000-3534600	Active TSS	Ovary	ovary
15	chr4:3533000-3534800	Active TSS	Left Ventricle	heart
16	chr4:3533000-3535000	Flanking Active TSS	Primary B cells from cord blood	blood
17	chr4:3533200-3534200	Active TSS	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
18	chr4:3533200-3534400	Active TSS	H1 Derived Mesenchymal Stem Cells	ES cell derived
19	chr4:3533200-3534400	Active TSS	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
20	chr4:3533200-3534400	Active TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
21	chr4:3533200-3534400	Active TSS	Foreskin Melanocyte Primary Cells skin03	Skin
22	chr4:3533200-3534400	Active TSS	Fetal Intestine Small	intestine
23	chr4:3533200-3534600	Active TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
24	chr4:3533200-3534600	Active TSS	iPS DF 6.9 Cell Line	embryonic stem cell
25	chr4:3533200-3534600	Active TSS	NHEK	skin
26	chr4:3533200-3534800	Active TSS	ES-WA7 Cell Line	embryonic stem cell
27	chr4:3533200-3534800	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
28	chr4:3533200-3534800	Active TSS	Aorta	Aorta
29	chr4:3533200-3535000	Active TSS	H9 Cell Line	embryonic stem cell
30	chr4:3533400-3534200	Active TSS	Stomach Smooth Muscle	stomach
31	chr4:3533400-3534400	Active TSS	ES-UCSF4 Cell Line	embryonic stem cell
32	chr4:3533400-3534400	Active TSS	Foreskin Fibroblast Primary Cells skin01	Skin
33	chr4:3533400-3534400	Active TSS	Foreskin Keratinocyte Primary Cells skin03	Skin
34	chr4:3533400-3534400	Active TSS	Brain Hippocampus Middle	brain
35	chr4:3533400-3534400	Active TSS	HSMMtube	muscle
36	chr4:3533400-3534600	Active TSS	Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells	embryonic stem cell
37	chr4:3533400-3534600	Active TSS	Esophagus	oesophagus
38	chr4:3533400-3534600	Active TSS	Lung	lung
39	chr4:3533400-3534600	Active TSS	Right Ventricle	heart
40	chr4:3533400-3534600	Active TSS	Sigmoid Colon	Sigmoid Colon
41	chr4:3533400-3534600	Active TSS	Stomach Mucosa	stomach
42	chr4:3533400-3534600	Active TSS	Hela-S3	cervix
43	chr4:3533400-3534800	Bivalent/Poised TSS	iPS-20b Cell Line	embryonic stem cell
44	chr4:3533400-3534800	Active TSS	Psoas Muscle	Psoas
45	chr4:3533400-3534800	Active TSS	A549	lung
46	chr4:3533400-3535000	Active TSS	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
47	chr4:3533600-3534000	Active TSS	Colonic Mucosa	Colon
48	chr4:3533600-3534200	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
49	chr4:3533600-3534200	Transcr. at gene 5' and 3'	Primary T helper naive cells fromperipheralblood	blood
50	chr4:3533600-3534200	Active TSS	Placenta	Placenta

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links