Variant report

Variant	rs200167142
Chromosome Location	chr5:180203494-180203495
allele	-/ATTATTAATTGTTAATTATTAATTA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr5:180202113..180204208-chr5:180208493..180210882,2	K562	blood:
2	chr5:180202321..180205166-chr5:180643152..180645917,2	K562	blood:

Extended variants
information (count: 55 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:55 , 50 per page) page: 1 2

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1030697	chr5:179710469-180686563	ZNF genes & repeats Enhancers Transcr. at gene 5' and 3' Genic enhancers Strong transcription Weak transcription Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	184 gene(s)	inside rSNPs	diseases
2	nsv1026417	chr5:179721376-180291360	Enhancers Weak transcription Transcr. at gene 5' and 3' Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	90 gene(s)	inside rSNPs	diseases
3	nsv1031836	chr5:179742033-180676122	Strong transcription Flanking Active TSS Transcr. at gene 5' and 3' Active TSS Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Weak transcription Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	177 gene(s)	inside rSNPs	diseases
4	nsv537984	chr5:179742033-180676122	Active TSS Bivalent Enhancer Flanking Active TSS Genic enhancers Weak transcription Flanking Bivalent TSS/Enh Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	177 gene(s)	inside rSNPs	diseases
5	nsv949199	chr5:179743553-180696889	Weak transcription Transcr. at gene 5' and 3' Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Strong transcription Flanking Active TSS Genic enhancers Bivalent/Poised TSS Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	182 gene(s)	inside rSNPs	diseases
6	nsv533204	chr5:180008319-180273638	Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Genic enhancers Weak transcription Strong transcription Active TSS Flanking Bivalent TSS/Enh Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	69 gene(s)	inside rSNPs	diseases
7	nsv1015152	chr5:180014800-180567614	Enhancers Bivalent/Poised TSS Weak transcription ZNF genes & repeats Active TSS Transcr. at gene 5' and 3' Strong transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA	89 gene(s)	inside rSNPs	diseases
8	nsv537987	chr5:180014800-180567614	Transcr. at gene 5' and 3' Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Active TSS Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA	89 gene(s)	inside rSNPs	diseases
9	nsv1034993	chr5:180059323-180686563	Enhancers Active TSS Flanking Active TSS Bivalent/Poised TSS Weak transcription Bivalent Enhancer ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	161 gene(s)	inside rSNPs	diseases
10	nsv534263	chr5:180063182-180696806	Flanking Active TSS Enhancers Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Weak transcription Transcr. at gene 5' and 3' Genic enhancers Strong transcription Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA	166 gene(s)	inside rSNPs	diseases
11	nsv1033330	chr5:180063241-180256969	Bivalent Enhancer Weak transcription Transcr. at gene 5' and 3' Active TSS Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Enhancers Genic enhancers Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
12	nsv537988	chr5:180063241-180256969	Enhancers Flanking Active TSS Strong transcription Bivalent/Poised TSS Weak transcription Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	45 gene(s)	inside rSNPs	diseases
13	nsv1029282	chr5:180069992-180251755	Flanking Bivalent TSS/Enh Weak transcription Enhancers Transcr. at gene 5' and 3' Flanking Active TSS Genic enhancers Bivalent Enhancer Strong transcription Bivalent/Poised TSS Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	42 gene(s)	inside rSNPs	diseases
14	nsv1025669	chr5:180069992-180686563	Active TSS Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers Weak transcription Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA	161 gene(s)	inside rSNPs	diseases
15	nsv1026991	chr5:180077614-180229093	Weak transcription Flanking Active TSS Enhancers Strong transcription Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	23 gene(s)	inside rSNPs	diseases
16	esv2757149	chr5:180079970-180245224	Enhancers Strong transcription Weak transcription Active TSS Flanking Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	42 gene(s)	inside rSNPs	diseases
17	esv2759399	chr5:180079970-180281476	Genic enhancers Transcr. at gene 5' and 3' Enhancers Active TSS Weak transcription Strong transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	65 gene(s)	inside rSNPs	diseases
18	nsv1030370	chr5:180080795-180216254	Weak transcription Flanking Active TSS Enhancers Strong transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases
19	esv2758033	chr5:180087198-180281476	Enhancers Weak transcription Active TSS Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	65 gene(s)	inside rSNPs	diseases
20	nsv1024943	chr5:180108841-180226865	Weak transcription Transcr. at gene 5' and 3' Strong transcription Genic enhancers Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
21	nsv1025777	chr5:180112337-180218662	Enhancers Strong transcription Genic enhancers Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
22	nsv537989	chr5:180112337-180218662	Strong transcription Enhancers Flanking Active TSS Weak transcription Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
23	nsv1032643	chr5:180112537-180218523	Enhancers Flanking Active TSS Weak transcription Genic enhancers Bivalent Enhancer Strong transcription Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
24	nsv537990	chr5:180112537-180218523	Genic enhancers Flanking Active TSS Weak transcription Strong transcription Enhancers Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
25	nsv1015640	chr5:180115817-180213878	Enhancers Active TSS Weak transcription Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
26	nsv1025379	chr5:180115817-180214853	Strong transcription Weak transcription Transcr. at gene 5' and 3' Enhancers Flanking Active TSS Genic enhancers Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
27	nsv1031928	chr5:180115817-180216254	Weak transcription Genic enhancers Bivalent Enhancer Enhancers Active TSS Transcr. at gene 5' and 3' Flanking Active TSS Strong transcription ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
28	nsv1015941	chr5:180119301-180208501	Enhancers Bivalent Enhancer Weak transcription ZNF genes & repeats Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
29	nsv537991	chr5:180119301-180208501	Enhancers Weak transcription ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
30	nsv1015329	chr5:180119301-180217029	Weak transcription Enhancers Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers Active TSS ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
31	nsv537992	chr5:180119301-180217029	Enhancers Flanking Active TSS Strong transcription Weak transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
32	nsv1030587	chr5:180119301-180229093	Genic enhancers Weak transcription Enhancers Flanking Active TSS Strong transcription Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	20 gene(s)	inside rSNPs	diseases
33	nsv537993	chr5:180119301-180686563	Weak transcription Active TSS Strong transcription Flanking Active TSS Enhancers Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA	158 gene(s)	inside rSNPs	diseases
34	nsv600671	chr5:180119918-180210656	Weak transcription Enhancers Active TSS Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
35	nsv462586	chr5:180119918-180213878	Flanking Active TSS Active TSS Enhancers Weak transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
36	nsv600672	chr5:180119918-180213878	Flanking Active TSS Weak transcription Enhancers Bivalent Enhancer Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Active TSS Flanking Bivalent TSS/Enh Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
37	nsv1028106	chr5:180120010-180228163	Transcr. at gene 5' and 3' Weak transcription Enhancers Strong transcription Genic enhancers Flanking Active TSS Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
38	nsv1024855	chr5:180120653-180216254	Weak transcription Enhancers Genic enhancers Strong transcription Flanking Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
39	nsv517459	chr5:180133616-180210656	Enhancers Weak transcription Bivalent Enhancer Active TSS ZNF genes & repeats Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
40	esv2755731	chr5:180136233-180226673	Weak transcription Enhancers Genic enhancers Strong transcription Flanking Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' ZNF genes & repeats Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
41	nsv432822	chr5:180136233-180226673	Genic enhancers Transcr. at gene 5' and 3' Enhancers Strong transcription Flanking Active TSS Weak transcription Active TSS Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
42	nsv1026978	chr5:180137823-180686563	Flanking Bivalent TSS/Enh Flanking Active TSS Enhancers Weak transcription Active TSS Strong transcription ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA	157 gene(s)	inside rSNPs	diseases
43	nsv1034735	chr5:180140115-180216254	Flanking Active TSS Enhancers Weak transcription Strong transcription Genic enhancers Transcr. at gene 5' and 3' Active TSS Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
44	nsv949443	chr5:180144688-180503368	Bivalent Enhancer Flanking Active TSS Enhancers Weak transcription Strong transcription Active TSS Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	77 gene(s)	inside rSNPs	diseases
45	nsv1032677	chr5:180151997-180686563	Enhancers Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Active TSS Bivalent Enhancer Strong transcription Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA	157 gene(s)	inside rSNPs	diseases
46	nsv1016991	chr5:180152407-180256970	Weak transcription Active TSS Enhancers Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers Strong transcription ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	41 gene(s)	inside rSNPs	diseases
47	nsv537994	chr5:180152407-180256970	Genic enhancers Enhancers Flanking Active TSS Weak transcription Strong transcription Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	41 gene(s)	inside rSNPs	diseases
48	nsv1023078	chr5:180157191-180216254	Enhancers Strong transcription Weak transcription Active TSS Genic enhancers Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
49	nsv1021689	chr5:180159694-180216254	Weak transcription Flanking Active TSS Enhancers Strong transcription Genic enhancers Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
50	nsv1016614	chr5:180163353-180216254	Active TSS Enhancers Flanking Active TSS Weak transcription Strong transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:2 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:180202800-180206000	Weak transcription	K562	blood
2	chr5:180203000-180212400	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links