Variant report

Variant	rs200626347
Chromosome Location	chr19:28486102-28486103
allele	-/TGTGTGTGTGTGTGTGTGTGTGTGTA
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 42 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:42 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1058373	chr19:27747981-28491356	ZNF genes & repeats Active TSS Weak transcription Enhancers Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
2	nsv1061090	chr19:27747981-28682929	ZNF genes & repeats Enhancers Weak transcription Active TSS Flanking Active TSS Strong transcription Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
3	nsv911513	chr19:27763440-28491875	Weak transcription ZNF genes & repeats Flanking Active TSS Strong transcription Enhancers Flanking Bivalent TSS/Enh Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
4	nsv911514	chr19:27763440-28496053	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
5	nsv911525	chr19:27794208-28491875	Weak transcription ZNF genes & repeats Enhancers Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
6	nsv911526	chr19:27794208-28496053	Weak transcription ZNF genes & repeats Bivalent Enhancer Enhancers Flanking Active TSS Strong transcription Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
7	nsv1063232	chr19:27853206-28569858	Enhancers Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3' Strong transcription Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	27 gene(s)	inside rSNPs	diseases
8	nsv543972	chr19:27853206-28569858	Weak transcription Strong transcription Enhancers ZNF genes & repeats Active TSS Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	27 gene(s)	inside rSNPs	diseases
9	nsv1055749	chr19:27853206-28740895	Weak transcription Strong transcription ZNF genes & repeats Active TSS Flanking Active TSS Enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
10	nsv543973	chr19:27853206-28740895	Weak transcription ZNF genes & repeats Enhancers Flanking Active TSS Strong transcription Active TSS Bivalent/Poised TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
11	nsv930989	chr19:27853207-28569857	Enhancers ZNF genes & repeats Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	27 gene(s)	inside rSNPs	diseases
12	nsv532819	chr19:27853207-28664723	ZNF genes & repeats Enhancers Weak transcription Strong transcription Flanking Active TSS Active TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
13	nsv530474	chr19:27853207-28740894	Active TSS ZNF genes & repeats Flanking Active TSS Enhancers Weak transcription Strong transcription Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
14	nsv911535	chr19:27861995-28491875	Weak transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
15	nsv911536	chr19:27861995-28496053	Weak transcription ZNF genes & repeats Enhancers Active TSS Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
16	esv2762966	chr19:27881186-28539281	Enhancers ZNF genes & repeats Active TSS Weak transcription Bivalent/Poised TSS Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
17	nsv911543	chr19:27893661-28496053	ZNF genes & repeats Weak transcription Genic enhancers Enhancers Flanking Active TSS Strong transcription Active TSS Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
18	nsv1058421	chr19:27919584-28491356	ZNF genes & repeats Flanking Active TSS Strong transcription Enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
19	nsv543977	chr19:27919584-28491356	Strong transcription Weak transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
20	nsv1061318	chr19:27919584-28509647	Flanking Active TSS Active TSS Weak transcription ZNF genes & repeats Enhancers Bivalent Enhancer Strong transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
21	nsv543978	chr19:27919584-28509647	ZNF genes & repeats Strong transcription Enhancers Weak transcription Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
22	nsv1060373	chr19:27919584-28530216	Enhancers ZNF genes & repeats Weak transcription Strong transcription Active TSS Bivalent Enhancer Flanking Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
23	nsv1055340	chr19:27919584-28755810	Weak transcription Enhancers ZNF genes & repeats Active TSS Genic enhancers Strong transcription Flanking Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
24	nsv1063211	chr19:27919584-28777862	Weak transcription Active TSS Enhancers ZNF genes & repeats Strong transcription Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
25	nsv543979	chr19:27919584-28777862	Enhancers Weak transcription ZNF genes & repeats Active TSS Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	30 gene(s)	inside rSNPs	diseases
26	nsv1059604	chr19:27919584-28814901	ZNF genes & repeats Weak transcription Enhancers Flanking Active TSS Active TSS Strong transcription Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	31 gene(s)	inside rSNPs	diseases
27	nsv1064493	chr19:27919584-28837984	Weak transcription Enhancers Strong transcription Flanking Active TSS ZNF genes & repeats Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	31 gene(s)	inside rSNPs	diseases
28	nsv911548	chr19:27948862-28845130	ZNF genes & repeats Flanking Active TSS Weak transcription Strong transcription Enhancers Active TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	31 gene(s)	inside rSNPs	diseases
29	nsv1066407	chr19:27975329-28491356	Weak transcription ZNF genes & repeats Enhancers Strong transcription Flanking Active TSS Active TSS Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
30	nsv1058414	chr19:28196208-28702108	Enhancers ZNF genes & repeats Strong transcription Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	29 gene(s)	inside rSNPs	diseases
31	nsv579196	chr19:28200288-29010504	ZNF genes & repeats Weak transcription Enhancers Active TSS Strong transcription Flanking Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	38 gene(s)	inside rSNPs	diseases
32	nsv911556	chr19:28243996-28888340	Weak transcription Active TSS Enhancers Strong transcription ZNF genes & repeats Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	29 gene(s)	inside rSNPs	diseases
33	nsv911557	chr19:28258780-28496053	Active TSS Weak transcription Enhancers ZNF genes & repeats Genic enhancers Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	21 gene(s)	inside rSNPs	diseases
34	nsv1064196	chr19:28315113-28554522	Enhancers Weak transcription ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Active TSS Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
35	esv3343415	chr19:28315698-28581894	Enhancers ZNF genes & repeats Weak transcription Active TSS Genic enhancers Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
36	nsv525352	chr19:28472343-28528306	Weak transcription Enhancers Flanking Active TSS Active TSS Bivalent Enhancer	TF binding region Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	n/a
37	nsv1064046	chr19:28472566-28539281	Enhancers Active TSS Weak transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats	TF binding region Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	n/a
38	nsv1060368	chr19:28476154-29085285	Weak transcription Enhancers Flanking Active TSS Genic enhancers ZNF genes & repeats Bivalent Enhancer Strong transcription Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
39	nsv911558	chr19:28484676-28552750	Enhancers Weak transcription ZNF genes & repeats Bivalent Enhancer Flanking Active TSS Active TSS	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	n/a
40	nsv911559	chr19:28484676-28569401	Enhancers Genic enhancers ZNF genes & repeats Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	n/a
41	nsv1061351	chr19:28485028-28554522	Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Active TSS	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	n/a
42	nsv543981	chr19:28485028-28554522	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Active TSS	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	n/a

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr19:28486000-28488600	Weak transcription	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links