Variant report

Variant	rs370291306
Chromosome Location	chr14:24492852-24492853
allele	-/GCTGGATGCATTCCCTTTGAAAATCG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 53 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:53 , 50 per page) page: 1 2

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	esv3405661	chr14:24189883-24670942	Strong transcription Enhancers Flanking Active TSS Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Weak transcription Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	131 gene(s)	inside rSNPs	diseases
2	nsv1217	chr14:24400565-24512689	Active TSS Enhancers Weak transcription Flanking Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	20 gene(s)	inside rSNPs	diseases
3	nsv1049316	chr14:24405420-24583724	Enhancers Active TSS Bivalent Enhancer Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Weak transcription Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	72 gene(s)	inside rSNPs	diseases
4	nsv541999	chr14:24405420-24583724	Enhancers Active TSS Weak transcription Flanking Active TSS Strong transcription ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	72 gene(s)	inside rSNPs	diseases
5	nsv1047294	chr14:24414285-24500633	Flanking Active TSS Active TSS Enhancers Weak transcription Strong transcription Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
6	nsv1039694	chr14:24414285-24500989	Enhancers Active TSS Weak transcription Flanking Active TSS ZNF genes & repeats Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	15 gene(s)	inside rSNPs	diseases
7	esv2761633	chr14:24423582-24513917	Flanking Active TSS Enhancers Weak transcription Active TSS Strong transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
8	nsv1050491	chr14:24426594-24495038	Flanking Active TSS Enhancers Weak transcription Strong transcription Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
9	nsv564047	chr14:24428509-24525634	Enhancers Weak transcription Flanking Active TSS Strong transcription Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	17 gene(s)	inside rSNPs	diseases
10	nsv901496	chr14:24429249-24501100	Flanking Active TSS Enhancers Active TSS Weak transcription Strong transcription Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
11	nsv901497	chr14:24429249-24514449	Active TSS Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases
12	nsv1040468	chr14:24429298-24495038	Flanking Active TSS Enhancers Weak transcription Active TSS Bivalent/Poised TSS ZNF genes & repeats Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
13	nsv1051259	chr14:24429298-24500243	Weak transcription Active TSS Enhancers Bivalent/Poised TSS Flanking Active TSS Strong transcription Bivalent Enhancer ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
14	nsv1044152	chr14:24429298-24500633	Weak transcription Enhancers Active TSS Flanking Active TSS Strong transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
15	nsv1054976	chr14:24429298-24500989	Flanking Active TSS Enhancers Active TSS Weak transcription Bivalent Enhancer Bivalent/Poised TSS Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
16	esv2760360	chr14:24429298-24501001	Weak transcription Enhancers Flanking Active TSS Active TSS Strong transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
17	nsv1052180	chr14:24429298-24555710	Bivalent Enhancer Weak transcription Enhancers Flanking Active TSS Active TSS Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	25 gene(s)	inside rSNPs	diseases
18	esv33403	chr14:24429613-24505105	Active TSS Weak transcription Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Bivalent/Poised TSS Bivalent Enhancer Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
19	nsv1043191	chr14:24444817-24500633	Enhancers Weak transcription Active TSS Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
20	nsv1039398	chr14:24444817-24500989	Weak transcription Enhancers Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
21	nsv1048811	chr14:24445622-24500243	Enhancers Flanking Active TSS Weak transcription Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
22	nsv1043008	chr14:24452689-24500117	Flanking Active TSS Enhancers Weak transcription Active TSS Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
23	nsv826901	chr14:24457315-24508468	Enhancers Flanking Active TSS Weak transcription Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	12 gene(s)	inside rSNPs	diseases
24	nsv91	chr14:24469668-24504712	Enhancers Active TSS Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	9 gene(s)	inside rSNPs	diseases
25	nsv1042033	chr14:24474511-24500989	Weak transcription Enhancers Active TSS Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	6 gene(s)	inside rSNPs	diseases
26	nsv1048292	chr14:24474511-24513905	Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
27	nsv9126	chr14:24475840-24505714	Weak transcription Active TSS Enhancers Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
28	nsv1050239	chr14:24478882-24500633	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Active TSS	Chromatin interactive region	6 gene(s)	inside rSNPs	diseases
29	nsv1051130	chr14:24478882-24500989	Weak transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats	TF binding region Chromatin interactive region	6 gene(s)	inside rSNPs	diseases
30	nsv1049192	chr14:24478882-24519250	Enhancers Active TSS Flanking Active TSS Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	13 gene(s)	inside rSNPs	diseases
31	nsv1037929	chr14:24478882-24522447	Bivalent Enhancer Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Active TSS Enhancers Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region	15 gene(s)	inside rSNPs	diseases
32	nsv1038704	chr14:24479375-24500989	Flanking Active TSS Enhancers Weak transcription ZNF genes & repeats Active TSS	TF binding region Chromatin interactive region	6 gene(s)	inside rSNPs	diseases
33	nsv1052857	chr14:24479375-24513905	Weak transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region	11 gene(s)	inside rSNPs	diseases
34	nsv1047643	chr14:24484459-24500243	Weak transcription Enhancers ZNF genes & repeats	Chromatin interactive region	n/a	inside rSNPs	diseases
35	nsv1045277	chr14:24484459-24500989	Enhancers Weak transcription ZNF genes & repeats	TF binding region Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
36	nsv1047042	chr14:24484459-24513905	Active TSS Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	10 gene(s)	inside rSNPs	diseases
37	esv3364187	chr14:24484812-24493310	Weak transcription Enhancers ZNF genes & repeats	Chromatin interactive region	n/a	inside rSNPs	diseases
38	nsv1045026	chr14:24488131-24499742	Enhancers Weak transcription	n/a	n/a	inside rSNPs	diseases
39	nsv1038262	chr14:24488131-24500117	Enhancers Weak transcription	n/a	n/a	inside rSNPs	diseases
40	nsv1046809	chr14:24488131-24500243	Weak transcription Enhancers	n/a	n/a	inside rSNPs	diseases
41	nsv1037632	chr14:24488131-24500633	Enhancers Weak transcription	n/a	n/a	inside rSNPs	diseases
42	nsv1051248	chr14:24488131-24500827	Enhancers Weak transcription	TF binding region	1 gene(s)	inside rSNPs	diseases
43	nsv1048992	chr14:24488131-24500989	Enhancers Weak transcription	TF binding region	1 gene(s)	inside rSNPs	diseases
44	nsv1038839	chr14:24488131-24510197	Enhancers Active TSS Flanking Active TSS Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	10 gene(s)	inside rSNPs	diseases
45	nsv1044763	chr14:24488131-24513905	Active TSS Enhancers Flanking Active TSS Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	10 gene(s)	inside rSNPs	diseases
46	nsv1051893	chr14:24488131-24519250	Flanking Active TSS Active TSS Enhancers Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	12 gene(s)	inside rSNPs	diseases
47	nsv1043854	chr14:24488131-24522447	Flanking Bivalent TSS/Enh Bivalent Enhancer Flanking Active TSS Active TSS Enhancers Bivalent/Poised TSS Weak transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	14 gene(s)	inside rSNPs	diseases
48	nsv1037921	chr14:24488384-24500633	Enhancers Weak transcription	n/a	n/a	inside rSNPs	diseases
49	nsv1049849	chr14:24488384-24513905	Flanking Active TSS Enhancers Active TSS Weak transcription Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region	10 gene(s)	inside rSNPs	diseases
50	nsv1049873	chr14:24488412-24500633	Enhancers Weak transcription	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr14:24492800-24494600	Enhancers	HepG2	liver

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links