Variant report

Variant rs377031337
Chromosome Location chr6:58778432-58778433
allele -/AAAAGGGAATATCTTTCCAT
Outlinks Ensembl   UCSC
Chromatin state (count:126 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr6:58773400-58779400 ZNF genes & repeats ES-I3 Cell Line embryonic stem cell
2 chr6:58773400-58779400 ZNF genes & repeats H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
3 chr6:58773400-58779400 ZNF genes & repeats H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
4 chr6:58773400-58779400 ZNF genes & repeats H9 Cell Line embryonic stem cell
5 chr6:58773400-58779400 ZNF genes & repeats HUES48 Cell Line embryonic stem cell
6 chr6:58773400-58779400 ZNF genes & repeats iPS-18 Cell Line embryonic stem cell
7 chr6:58773400-58779400 ZNF genes & repeats Adipose Nuclei Adipose
8 chr6:58773400-58779400 ZNF genes & repeats Fetal Stomach stomach
9 chr6:58773400-58779400 ZNF genes & repeats Left Ventricle heart
10 chr6:58773600-58779200 ZNF genes & repeats Fetal Adrenal Gland Adrenal Gland
11 chr6:58773600-58779400 ZNF genes & repeats ES-WA7 Cell Line embryonic stem cell
12 chr6:58773600-58779400 ZNF genes & repeats HUES6 Cell Line embryonic stem cell
13 chr6:58773600-58779400 ZNF genes & repeats HUES64 Cell Line embryonic stem cell
14 chr6:58773600-58779400 ZNF genes & repeats iPS-20b Cell Line embryonic stem cell
15 chr6:58773600-58779400 ZNF genes & repeats Primary B cells from cord blood blood
16 chr6:58773600-58779400 ZNF genes & repeats Primary T cells fromperipheralblood blood
17 chr6:58773600-58779400 ZNF genes & repeats Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
18 chr6:58773600-58779400 ZNF genes & repeats Fetal Intestine Large intestine
19 chr6:58776200-58779400 Flanking Bivalent TSS/Enh hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
20 chr6:58776400-58779200 ZNF genes & repeats Foreskin Keratinocyte Primary Cells skin02 Skin
21 chr6:58776400-58779400 ZNF genes & repeats ES-UCSF4 Cell Line embryonic stem cell
22 chr6:58776400-58779400 Flanking Bivalent TSS/Enh Primary T regulatory cells fromperipheralblood blood
23 chr6:58776400-58779400 Flanking Bivalent TSS/Enh Primary hematopoietic stem cells G-CSF-mobilized Female --
24 chr6:58776400-58779400 Flanking Bivalent TSS/Enh Psoas Muscle Psoas
25 chr6:58776400-58779400 ZNF genes & repeats Monocytes-CD14+_RO01746 blood
26 chr6:58776600-58778800 Bivalent/Poised TSS K562 blood
27 chr6:58776600-58779200 ZNF genes & repeats IMR90 fetal lung fibroblasts Cell Line lung
28 chr6:58776600-58779200 ZNF genes & repeats Primary monocytes fromperipheralblood blood
29 chr6:58776600-58779200 ZNF genes & repeats Primary hematopoietic stem cells G-CSF-mobilized Male --
30 chr6:58776600-58779200 ZNF genes & repeats Ganglion Eminence derived primary cultured neurospheres brain
31 chr6:58776600-58779200 ZNF genes & repeats Foreskin Fibroblast Primary Cells skin01 Skin
32 chr6:58776600-58779200 ZNF genes & repeats Foreskin Fibroblast Primary Cells skin02 Skin
33 chr6:58776600-58779200 ZNF genes & repeats Foreskin Melanocyte Primary Cells skin01 Skin
34 chr6:58776600-58779200 ZNF genes & repeats Fetal Brain Male brain
35 chr6:58776600-58779200 ZNF genes & repeats Fetal Brain Female brain
36 chr6:58776600-58779200 ZNF genes & repeats Fetal Heart heart
37 chr6:58776600-58779200 ZNF genes & repeats Fetal Muscle Trunk muscle
38 chr6:58776600-58779200 ZNF genes & repeats Lung lung
39 chr6:58776600-58779200 Flanking Bivalent TSS/Enh Placenta Amnion Placenta Amnion
40 chr6:58776600-58779200 ZNF genes & repeats Skeletal Muscle Male skeletal muscle
41 chr6:58776600-58779200 Flanking Bivalent TSS/Enh A549 lung
42 chr6:58776600-58779200 ZNF genes & repeats GM12878-XiMat blood
43 chr6:58776600-58779200 ZNF genes & repeats HMEC breast
44 chr6:58776600-58779200 Transcr. at gene 5' and 3' NHEK skin
45 chr6:58776600-58779400 Flanking Bivalent TSS/Enh H1 Cell Line embryonic stem cell
46 chr6:58776600-58779400 ZNF genes & repeats H1 Derived Mesenchymal Stem Cells ES cell derived
47 chr6:58776600-58779400 Flanking Bivalent TSS/Enh H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
48 chr6:58776600-58779400 Flanking Bivalent TSS/Enh hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
49 chr6:58776600-58779400 ZNF genes & repeats hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
50 chr6:58776600-58779400 ZNF genes & repeats iPS-15b Cell Line embryonic stem cell

Quick Search:


  
Input of quick search could be:

what's new

Quick links