Variant report

Variant	rs532344963
Chromosome Location	chr10:1668145-1668146
allele	-/CGGATGCTAACCCCACGTCTGCC
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 21 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:21 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv530117	chr10:945438-1729634	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3' Active TSS Strong transcription Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
2	nsv817532	chr10:964660-1885945	Bivalent/Poised TSS Enhancers Strong transcription Flanking Active TSS Active TSS Weak transcription Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
3	nsv1041498	chr10:1117200-1760190	Genic enhancers Strong transcription Weak transcription Enhancers Active TSS Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	12 gene(s)	inside rSNPs	diseases
4	nsv1052682	chr10:1162925-1675641	Bivalent/Poised TSS Weak transcription Strong transcription Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Flanking Active TSS Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	9 gene(s)	inside rSNPs	diseases
5	nsv1046041	chr10:1195214-2189155	Enhancers Bivalent Enhancer Bivalent/Poised TSS Weak transcription Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Strong transcription Active TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	16 gene(s)	inside rSNPs	diseases
6	nsv1037054	chr10:1232041-1865296	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
7	nsv540413	chr10:1232041-1865296	Bivalent/Poised TSS Bivalent Enhancer Enhancers Flanking Active TSS Weak transcription Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
8	nsv549769	chr10:1244020-1764966	Enhancers Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
9	nsv549786	chr10:1293100-1904598	Flanking Bivalent TSS/Enh Enhancers Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Weak transcription Strong transcription Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
10	nsv894736	chr10:1513349-1672408	Active TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Genic enhancers Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
11	nsv1054555	chr10:1558145-1965145	Enhancers Weak transcription Bivalent/Poised TSS ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent Enhancer Active TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
12	nsv894737	chr10:1560338-1692796	Bivalent Enhancer Enhancers Bivalent/Poised TSS Weak transcription ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
13	nsv1052401	chr10:1582012-1964762	Flanking Active TSS Bivalent Enhancer Enhancers Weak transcription ZNF genes & repeats Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
14	nsv540417	chr10:1582012-1964762	Enhancers Flanking Active TSS Bivalent Enhancer Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Weak transcription ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
15	nsv894738	chr10:1613026-1791836	Bivalent Enhancer Enhancers Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Weak transcription Bivalent/Poised TSS Flanking Active TSS Genic enhancers	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
16	nsv1047729	chr10:1640337-1675641	Weak transcription Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Active TSS Genic enhancers	Chromatin interactive region	n/a	inside rSNPs	diseases
17	nsv894739	chr10:1643368-1669110	Enhancers Weak transcription Bivalent/Poised TSS Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Genic enhancers	Chromatin interactive region	n/a	inside rSNPs	diseases
18	nsv894740	chr10:1646899-1675548	Enhancers Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
19	nsv549796	chr10:1665211-1747923	Weak transcription Enhancers ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Genic enhancers	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
20	nsv1043576	chr10:1667645-1901205	Weak transcription Bivalent/Poised TSS Enhancers Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Bivalent Enhancer ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
21	esv11707	chr10:1668101-1668606	Weak transcription ZNF genes & repeats Enhancers	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:5 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr10:1651800-1671200	Weak transcription	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
2	chr10:1659200-1671800	Weak transcription	iPS DF 6.9 Cell Line	embryonic stem cell
3	chr10:1663400-1670600	Weak transcription	Right Atrium	heart
4	chr10:1668000-1668200	Enhancers	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
5	chr10:1668000-1668200	Weak transcription	iPS DF 19.11 Cell Line	embryonic stem cell

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links