Variant report

Variant	rs540391796
Chromosome Location	chr1:189675988-189675989
allele	-/TGCAGATGGAAGTATAAACTACACCATT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 41 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:41 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv999435	chr1:188997868-189849121	Weak transcription Active TSS Enhancers Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
2	nsv1012877	chr1:189035500-189804333	Weak transcription Enhancers Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
3	nsv534452	chr1:189129332-189924389	Weak transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
4	nsv872662	chr1:189211622-189741561	Active TSS Enhancers Weak transcription ZNF genes & repeats Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
5	nsv872673	chr1:189238665-189731048	Enhancers Weak transcription Active TSS Flanking Active TSS ZNF genes & repeats Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
6	nsv872683	chr1:189286816-189748851	Enhancers Flanking Active TSS ZNF genes & repeats Weak transcription Active TSS Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
7	nsv427863	chr1:189356268-189709137	Enhancers Active TSS Weak transcription ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
8	nsv1003741	chr1:189447275-189702125	Enhancers Weak transcription Active TSS Flanking Active TSS Genic enhancers Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
9	nsv535241	chr1:189447275-189702125	Enhancers Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh	TF binding region Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
10	nsv1005794	chr1:189488465-190063923	Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
11	nsv872710	chr1:189512884-189695297	Enhancers Flanking Active TSS Weak transcription Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
12	nsv872712	chr1:189528943-189731048	Enhancers Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS Genic enhancers	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
13	nsv872715	chr1:189543576-189731048	Enhancers Active TSS Weak transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
14	nsv1009290	chr1:189554045-189908459	Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS Bivalent Enhancer Active TSS Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
15	nsv497885	chr1:189562225-190086077	Enhancers Flanking Active TSS Active TSS Weak transcription Bivalent Enhancer Strong transcription ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
16	nsv872716	chr1:189568547-189736833	Flanking Active TSS Active TSS Enhancers Weak transcription Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
17	nsv872717	chr1:189585380-189748851	Enhancers Weak transcription Flanking Active TSS Bivalent Enhancer Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases
18	nsv872718	chr1:189589339-189731048	Enhancers Weak transcription Active TSS Bivalent Enhancer Flanking Active TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
19	nsv872719	chr1:189602917-189731048	Enhancers Flanking Active TSS Weak transcription Active TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
20	nsv868954	chr1:189605447-190135265	Enhancers Flanking Active TSS Weak transcription ZNF genes & repeats Active TSS Bivalent Enhancer Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
21	nsv872720	chr1:189620278-189731048	Flanking Active TSS Enhancers Weak transcription Bivalent Enhancer Active TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
22	nsv872721	chr1:189623964-189731048	Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
23	nsv872722	chr1:189627183-189678231	Weak transcription Bivalent Enhancer Enhancers Active TSS Flanking Active TSS	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
24	nsv872723	chr1:189627183-189679539	Enhancers Active TSS Bivalent Enhancer Flanking Active TSS Weak transcription	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
25	nsv872724	chr1:189627183-189717659	Enhancers Active TSS Weak transcription Flanking Active TSS Bivalent Enhancer	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
26	nsv872725	chr1:189627183-189731048	Enhancers Bivalent Enhancer Weak transcription Flanking Active TSS Active TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
27	nsv872726	chr1:189627183-189742133	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS	TF binding region CpG island Chromatin interactive region	3 gene(s)	inside rSNPs	diseases
28	nsv466672	chr1:189630723-189678231	Enhancers Weak transcription Flanking Active TSS Active TSS Bivalent Enhancer	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
29	nsv548525	chr1:189630723-189678231	Enhancers Flanking Active TSS Active TSS Weak transcription Bivalent Enhancer	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
30	nsv548526	chr1:189630723-189717659	Enhancers Bivalent Enhancer Flanking Active TSS Active TSS Weak transcription	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
31	nsv872727	chr1:189630723-189717659	Weak transcription Active TSS Bivalent Enhancer Flanking Active TSS Enhancers	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
32	nsv548527	chr1:189630723-189723490	Active TSS Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
33	nsv548529	chr1:189639180-189678231	Bivalent Enhancer Enhancers Weak transcription Active TSS Flanking Active TSS	TF binding region Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
34	nsv872728	chr1:189642442-189731048	Weak transcription Flanking Active TSS Enhancers Active TSS	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
35	nsv872729	chr1:189642442-189741561	Enhancers Flanking Active TSS Active TSS Weak transcription	TF binding region CpG island Chromatin interactive region	2 gene(s)	inside rSNPs	diseases
36	nsv872730	chr1:189645319-189731048	Enhancers Active TSS Flanking Active TSS Weak transcription	Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
37	nsv872731	chr1:189653244-189741561	Enhancers Weak transcription Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
38	nsv872732	chr1:189653244-189758533	Active TSS Enhancers Flanking Active TSS Weak transcription	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
39	nsv872733	chr1:189662841-189733979	Enhancers Flanking Active TSS Weak transcription Active TSS	Chromatin interactive region	n/a	inside rSNPs	diseases
40	nsv548530	chr1:189664857-189775775	Active TSS Enhancers Weak transcription Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
41	nsv3921	chr1:189668405-189810638	Enhancers Weak transcription Active TSS Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	4 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr1:189675200-189676200	Enhancers	IMR90 fetal lung fibroblasts Cell Line	lung

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links