Variant report

Variant	rs543786186
Chromosome Location	chr7:149471142-149471143
allele	-/GGGGCTGGGCGGAGATTCTGAGGGCG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	EBF1	chr7:149470864-149471158	GM12878	blood:	n/a	chr7:149471086-149471099 chr7:149471087-149471097 chr7:149471088-149471097
2	ZNF263	chr7:149470108-149473120	HEK293-T-REx	kidney:	n/a	chr7:149470699-149470708 chr7:149470346-149470355 chr7:149470400-149470409 chr7:149471474-149471483 chr7:149471988-149471997 chr7:149470746-149470755
3	POLR2A	chr7:149470243-149471504	K562	blood:	n/a	n/a
4	POLR2A	chr7:149470041-149471169	K562	blood:	n/a	n/a
5	ZBTB7A	chr7:149469944-149471323	K562	blood:	n/a	n/a
6	TCF12	chr7:149470661-149471143	A549	lung:	n/a	n/a
7	ZBTB7A	chr7:149470741-149471516	ECC-1	luminal epithelium:	n/a	n/a
8	UBTF	chr7:149470146-149471578	K562	blood:	n/a	n/a
9	POLR2A	chr7:149470197-149471150	SK-N-MC	brain:	n/a	n/a
10	PBX3	chr7:149470740-149471171	A549	lung:	n/a	n/a
11	POLR2A	chr7:149470471-149471187	HCT-116	colon:	n/a	n/a
12	MAZ	chr7:149467973-149472216	K562	blood:	n/a	chr7:149469385-149469395 chr7:149471984-149471994 chr7:149470414-149470424 chr7:149469471-149469481 chr7:149470453-149470463
13	CCNT2	chr7:149470128-149471821	K562	blood:	n/a	chr7:149470896-149470905
14	ZBTB7A	chr7:149469353-149471361	ECC-1	luminal epithelium:	n/a	chr7:149469629-149469638
15	ZNF263	chr7:149470092-149472573	K562	blood:	n/a	chr7:149470699-149470708 chr7:149470346-149470355 chr7:149470400-149470409 chr7:149471474-149471483 chr7:149471988-149471997 chr7:149470746-149470755
16	ZBTB7A	chr7:149470796-149471150	K562	blood:	n/a	n/a
17	HMGN3	chr7:149470074-149471765	K562	blood:	n/a	n/a
18	SIN3A	chr7:149470782-149471857	H1-hESC	embryonic stem cell:	n/a	chr7:149471142-149471153

No.	Distal block	Cell Line	Cell type
1	chr7:149425054..149427794-chr7:149470002..149471582,2	MCF-7	breast:
2	chr7:149470006..149471576-chr7:149569800..149572611,2	MCF-7	breast:
3	chr7:149318463..149321667-chr7:149470267..149475750,6	K562	blood:
4	chr7:149468811..149471165-chr7:149492241..149495834,3	K562	blood:
5	chr7:149468652..149471157-chr7:150776207..150778297,2	MCF-7	breast:
6	chr7:149469665..149471242-chr7:149492952..149494694,2	K562	blood:
7	chr7:149470907..149472534-chr7:149538103..149539944,2	MCF-7	breast:
8	chr7:149469487..149472454-chr7:149520687..149524368,4	MCF-7	breast:
9	chr7:149467684..149471867-chr7:149482733..149487472,6	K562	blood:

No.	lncRNA name	Chromosome Location	lncRNA alias
1	lnc-KRBA1-2	chr7:149470297-149473130	NONHSAT124042

Variant related genes	Relation type
SSPO	TF binding region
ZNF467	TF binding region
ENSG00000164896	Chromatin interaction
ENSG00000204934	Chromatin interaction
ENSG00000171130	Chromatin interaction
ENSG00000133624	Chromatin interaction
ENSG00000133619	Chromatin interaction
ENSG00000197558	Chromatin interaction

Extended variants
information (count: 40 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:40 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1034350	chr7:149264094-149666356	Weak transcription ZNF genes & repeats Enhancers Flanking Bivalent TSS/Enh Strong transcription Active TSS Flanking Active TSS Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
2	nsv539190	chr7:149264094-149666356	Flanking Active TSS Genic enhancers Weak transcription Active TSS Enhancers Bivalent Enhancer ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
3	nsv1023901	chr7:149364044-149747442	Enhancers Weak transcription Active TSS Bivalent Enhancer Strong transcription Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	40 gene(s)	inside rSNPs	diseases
4	nsv539191	chr7:149364044-149747442	Active TSS Enhancers Strong transcription Weak transcription Genic enhancers Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	40 gene(s)	inside rSNPs	diseases
5	nsv469576	chr7:149379626-149563233	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Strong transcription Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	21 gene(s)	inside rSNPs	diseases
6	nsv1031581	chr7:149386249-149570178	Weak transcription Flanking Active TSS Active TSS Enhancers Bivalent Enhancer ZNF genes & repeats Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	31 gene(s)	inside rSNPs	diseases
7	nsv539192	chr7:149386249-149570178	Genic enhancers Weak transcription Enhancers Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Bivalent Enhancer Bivalent/Poised TSS Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	31 gene(s)	inside rSNPs	diseases
8	nsv831184	chr7:149424835-149600093	Weak transcription Flanking Active TSS Active TSS Enhancers Flanking Bivalent TSS/Enh Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	33 gene(s)	inside rSNPs	diseases
9	esv2758139	chr7:149441590-149956415	Strong transcription Active TSS Bivalent Enhancer Weak transcription Enhancers ZNF genes & repeats Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	40 gene(s)	inside rSNPs	diseases
10	esv2759571	chr7:149441590-149956415	Strong transcription Weak transcription Enhancers Active TSS Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	40 gene(s)	inside rSNPs	diseases
11	nsv465200	chr7:149445585-149483373	Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Enhancers Active TSS Bivalent Enhancer Strong transcription Weak transcription ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
12	nsv608980	chr7:149445585-149483373	Weak transcription Bivalent/Poised TSS Active TSS Bivalent Enhancer Enhancers Genic enhancers Flanking Bivalent TSS/Enh Flanking Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
13	nsv608981	chr7:149446246-149513152	Active TSS Enhancers Bivalent Enhancer Weak transcription Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
14	nsv608982	chr7:149450584-149483373	Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Active TSS Flanking Active TSS Bivalent/Poised TSS Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
15	nsv465201	chr7:149450584-149485059	Enhancers Active TSS Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription Weak transcription Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
16	nsv608983	chr7:149450584-149485059	Weak transcription Enhancers Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Active TSS Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
17	nsv465202	chr7:149450584-149499412	Flanking Active TSS Bivalent Enhancer Active TSS Weak transcription Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Strong transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
18	nsv608984	chr7:149450584-149499412	Enhancers Flanking Active TSS Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3' Strong transcription Genic enhancers ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
19	nsv465203	chr7:149456359-149483373	Weak transcription Flanking Active TSS Bivalent/Poised TSS Active TSS Enhancers Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
20	nsv608985	chr7:149456359-149483373	Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Bivalent Enhancer Genic enhancers Weak transcription Flanking Active TSS Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
21	nsv889403	chr7:149456359-149509981	Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
22	nsv517242	chr7:149456359-149536214	Bivalent Enhancer Flanking Active TSS Active TSS Enhancers Weak transcription Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
23	nsv465204	chr7:149458128-149485059	Flanking Bivalent TSS/Enh Bivalent Enhancer Enhancers Weak transcription Flanking Active TSS Bivalent/Poised TSS Active TSS Genic enhancers Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
24	nsv608986	chr7:149458128-149485059	Active TSS Flanking Bivalent TSS/Enh Enhancers Bivalent Enhancer Bivalent/Poised TSS Weak transcription Genic enhancers Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
25	nsv889404	chr7:149458623-149500992	Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Weak transcription Enhancers Strong transcription Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
26	nsv889405	chr7:149458623-149500992	Bivalent/Poised TSS Bivalent Enhancer Flanking Active TSS Active TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription Genic enhancers ZNF genes & repeats Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
27	nsv889406	chr7:149458623-149522366	Flanking Active TSS Active TSS Bivalent Enhancer Enhancers ZNF genes & repeats Bivalent/Poised TSS Weak transcription Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
28	nsv889407	chr7:149458623-149536214	Weak transcription Bivalent/Poised TSS Genic enhancers Active TSS Flanking Active TSS Enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
29	nsv889408	chr7:149458623-149539138	Enhancers Active TSS Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription ZNF genes & repeats Strong transcription Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
30	nsv521861	chr7:149458623-149582906	Weak transcription Bivalent/Poised TSS Enhancers Flanking Active TSS Genic enhancers Bivalent Enhancer Active TSS Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	32 gene(s)	inside rSNPs	diseases
31	nsv889409	chr7:149458623-149585379	Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Active TSS Weak transcription Bivalent Enhancer Genic enhancers Strong transcription Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	32 gene(s)	inside rSNPs	diseases
32	esv1820919	chr7:149459787-149532882	Weak transcription Bivalent Enhancer Active TSS Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
33	nsv889410	chr7:149460447-149500992	Enhancers Active TSS Flanking Active TSS Strong transcription Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
34	esv1816660	chr7:149462712-149529460	Weak transcription Flanking Active TSS Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
35	nsv889411	chr7:149465674-149539138	Flanking Bivalent TSS/Enh ZNF genes & repeats Active TSS Bivalent/Poised TSS Flanking Active TSS Enhancers Bivalent Enhancer Weak transcription Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
36	nsv970603	chr7:149466120-149478339	Weak transcription Enhancers Active TSS Genic enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
37	esv1791871	chr7:149466725-149516442	Enhancers Bivalent/Poised TSS Weak transcription Flanking Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Active TSS Transcr. at gene 5' and 3' Genic enhancers Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
38	esv3357102	chr7:149467319-149472417	Active TSS Bivalent/Poised TSS Enhancers Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent Enhancer Weak transcription Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	n/a
39	esv3399863	chr7:149468069-149471792	Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Flanking Active TSS Enhancers Weak transcription Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	n/a
40	esv3397814	chr7:149468844-149471392	Active TSS Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer Enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	n/a

No data

Chromatin state (count:98 , 50 per page) page: 1 2

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr7:149468200-149471200	Active TSS	Pancreatic Islets	Pancreatic Islet
2	chr7:149468200-149471600	Active TSS	Duodenum Smooth Muscle	Duodenum
3	chr7:149468400-149471200	Active TSS	Colon Smooth Muscle	Colon
4	chr7:149468400-149471200	Active TSS	Psoas Muscle	Psoas
5	chr7:149468400-149471200	Active TSS	Right Ventricle	heart
6	chr7:149468400-149471400	Active TSS	H9 Cell Line	embryonic stem cell
7	chr7:149468400-149471400	Active TSS	Rectal Mucosa Donor 29	rectum
8	chr7:149468400-149471400	Active TSS	Rectal Smooth Muscle	rectum
9	chr7:149468400-149471600	Active TSS	Left Ventricle	heart
10	chr7:149468400-149471800	Bivalent/Poised TSS	Fetal Intestine Large	intestine
11	chr7:149468600-149471200	Active TSS	iPS-15b Cell Line	embryonic stem cell
12	chr7:149468600-149471200	Active TSS	iPS DF 6.9 Cell Line	embryonic stem cell
13	chr7:149468600-149471200	Active TSS	Breast Myoepithelial Primary Cells	Breast
14	chr7:149468600-149471200	Active TSS	Primary T helper memory cells from peripheral blood 2	blood
15	chr7:149468600-149471200	Active TSS	Aorta	Aorta
16	chr7:149468600-149471200	Active TSS	Esophagus	oesophagus
17	chr7:149468600-149471200	Active TSS	Lung	lung
18	chr7:149468600-149471200	Active TSS	Ovary	ovary
19	chr7:149468600-149471200	Active TSS	Pancreas	Pancrea
20	chr7:149468600-149471400	Active TSS	Brain Anterior Caudate	brain
21	chr7:149468600-149471400	Active TSS	Skeletal Muscle Female	skeletal muscle
22	chr7:149468800-149471200	Active TSS	K562	blood
23	chr7:149469000-149471400	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
24	chr7:149469000-149471800	Bivalent/Poised TSS	Fetal Brain Female	brain
25	chr7:149469200-149471200	Bivalent Enhancer	Fetal Brain Male	brain
26	chr7:149469600-149471400	Bivalent/Poised TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
27	chr7:149469800-149471600	Bivalent/Poised TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
28	chr7:149470000-149471200	Flanking Active TSS	H1 Derived Mesenchymal Stem Cells	ES cell derived
29	chr7:149470200-149471200	Active TSS	ES-WA7 Cell Line	embryonic stem cell
30	chr7:149470200-149471200	Flanking Bivalent TSS/Enh	IMR90 fetal lung fibroblasts Cell Line	lung
31	chr7:149470200-149471200	Bivalent/Poised TSS	iPS-18 Cell Line	embryonic stem cell
32	chr7:149470200-149471200	Flanking Bivalent TSS/Enh	Primary T regulatory cells fromperipheralblood	blood
33	chr7:149470200-149471200	Flanking Bivalent TSS/Enh	Foreskin Fibroblast Primary Cells skin01	Skin
34	chr7:149470200-149471200	Flanking Bivalent TSS/Enh	Foreskin Melanocyte Primary Cells skin03	Skin
35	chr7:149470200-149471400	Bivalent/Poised TSS	H1 Cell Line	embryonic stem cell
36	chr7:149470200-149471400	Bivalent/Poised TSS	HUES6 Cell Line	embryonic stem cell
37	chr7:149470200-149471400	Bivalent/Poised TSS	HUES64 Cell Line	embryonic stem cell
38	chr7:149470200-149471400	Flanking Active TSS	Primary hematopoietic stem cells G-CSF-mobilized Male	--
39	chr7:149470200-149471600	Bivalent/Poised TSS	ES-I3 Cell Line	embryonic stem cell
40	chr7:149470200-149471600	Bivalent/Poised TSS	HUES48 Cell Line	embryonic stem cell
41	chr7:149470200-149471600	Bivalent/Poised TSS	iPS-20b Cell Line	embryonic stem cell
42	chr7:149470600-149471200	Bivalent/Poised TSS	Foreskin Melanocyte Primary Cells skin01	Skin
43	chr7:149470600-149471200	Active TSS	Colonic Mucosa	Colon
44	chr7:149470600-149471400	Weak transcription	Primary T helper naive cells from peripheral blood	blood
45	chr7:149470600-149471400	Weak transcription	Fetal Kidney	kidney
46	chr7:149470600-149472000	Bivalent/Poised TSS	Foreskin Fibroblast Primary Cells skin02	Skin
47	chr7:149470600-149472000	Enhancers	Liver	Liver
48	chr7:149470600-149472200	Active TSS	Stomach Smooth Muscle	stomach
49	chr7:149470600-149472600	Weak transcription	Fetal Lung	lung
50	chr7:149470600-149476400	Enhancers	H9 Derived Neuron Cultured Cells	ES cell derived

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links