Variant report

Variant rs556739603
Chromosome Location chr15:75499963-75499964
allele -/CTGAGCCTGACTCTGCCACAG
Outlinks Ensembl   UCSC
Chromatin state (count:124 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr15:75495800-75500000 Weak transcription Brain Germinal Matrix brain
2 chr15:75496200-75506000 Weak transcription Fetal Brain Female brain
3 chr15:75496400-75500400 Weak transcription Right Atrium heart
4 chr15:75496400-75504000 Weak transcription HSMMtube muscle
5 chr15:75496400-75506000 Weak transcription Psoas Muscle Psoas
6 chr15:75496600-75501600 Weak transcription Brain Substantia Nigra brain
7 chr15:75496600-75506600 Weak transcription Primary T helper memory cells from peripheral blood 1 blood
8 chr15:75496800-75500400 Weak transcription Pancreatic Islets Pancreatic Islet
9 chr15:75496800-75507200 Weak transcription NH-A brain
10 chr15:75497200-75500200 Weak transcription Brain Anterior Caudate brain
11 chr15:75497600-75500200 Weak transcription NHDF-Ad bronchial
12 chr15:75497600-75500400 Weak transcription Brain Inferior Temporal Lobe brain
13 chr15:75497600-75500600 Weak transcription Primary T helper memory cells from peripheral blood 2 blood
14 chr15:75497600-75501000 Weak transcription Brain Cingulate Gyrus brain
15 chr15:75497600-75501200 Weak transcription Brain Angular Gyrus brain
16 chr15:75497600-75501400 Weak transcription Primary T helper naive cells from peripheral blood blood
17 chr15:75497600-75501400 Strong transcription Primary mononuclear cells fromperipheralblood Blood
18 chr15:75497600-75501600 Genic enhancers Primary hematopoietic stem cells G-CSF-mobilized Female --
19 chr15:75497600-75507000 Weak transcription hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
20 chr15:75497800-75500200 Weak transcription ES-I3 Cell Line embryonic stem cell
21 chr15:75497800-75500200 Weak transcription Primary T killer memory cells from peripheral blood blood
22 chr15:75497800-75500400 Strong transcription Dnd41 blood
23 chr15:75497800-75500600 Weak transcription Fetal Heart heart
24 chr15:75497800-75501200 Strong transcription Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
25 chr15:75497800-75501400 Genic enhancers Primary hematopoietic stem cells G-CSF-mobilized Male --
26 chr15:75497800-75501800 Strong transcription Fetal Thymus thymus
27 chr15:75497800-75502200 Genic enhancers Primary hematopoietic stem cells short term culture blood
28 chr15:75497800-75504200 Strong transcription Hela-S3 cervix
29 chr15:75497800-75505200 Strong transcription hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
30 chr15:75497800-75506400 Weak transcription ES-WA7 Cell Line embryonic stem cell
31 chr15:75498000-75500200 Genic enhancers Primary Natural Killer cells fromperipheralblood blood
32 chr15:75498000-75500400 Strong transcription Rectal Mucosa Donor 29 rectum
33 chr15:75498000-75501200 Strong transcription Primary neutrophils fromperipheralblood blood
34 chr15:75498000-75501200 Strong transcription Primary T cells fromperipheralblood blood
35 chr15:75498000-75502000 Strong transcription Primary T helper naive cells fromperipheralblood blood
36 chr15:75498000-75502000 Strong transcription Foreskin Keratinocyte Primary Cells skin03 Skin
37 chr15:75498000-75502800 Genic enhancers Monocytes-CD14+_RO01746 blood
38 chr15:75498000-75503000 Strong transcription Foreskin Keratinocyte Primary Cells skin02 Skin
39 chr15:75498000-75503000 Genic enhancers Duodenum Mucosa Duodenum
40 chr15:75498000-75503000 Strong transcription NHEK skin
41 chr15:75498000-75503200 Genic enhancers Placenta Placenta
42 chr15:75498000-75504000 Transcr. at gene 5' and 3' GM12878-XiMat blood
43 chr15:75498000-75504200 Strong transcription hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
44 chr15:75498000-75504400 Genic enhancers Fetal Adrenal Gland Adrenal Gland
45 chr15:75498000-75505800 Strong transcription iPS-20b Cell Line embryonic stem cell
46 chr15:75498000-75505800 Strong transcription Rectal Mucosa Donor 31 rectum
47 chr15:75498000-75506000 Strong transcription Thymus Thymus
48 chr15:75498000-75507000 Genic enhancers Spleen Spleen
49 chr15:75498200-75500200 Weak transcription Primary T killer naive cells fromperipheralblood blood
50 chr15:75498200-75500400 Strong transcription Lung lung

Quick Search:


  
Input of quick search could be:

what's new

Quick links