Variant report

Variant	rs568673152
Chromosome Location	chr8:53439068-53439069
allele	-/TACATATATTAAATAATATAT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 46 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:46 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv817380	chr8:53207304-54016570	Bivalent Enhancer Weak transcription Active TSS Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	24 gene(s)	inside rSNPs	diseases
2	nsv890900	chr8:53265220-53491159	Weak transcription Enhancers Bivalent Enhancer Active TSS Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
3	nsv890901	chr8:53265220-53528204	Bivalent/Poised TSS Enhancers Active TSS ZNF genes & repeats Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
4	esv2761192	chr8:53278309-53613251	Weak transcription Active TSS Enhancers Strong transcription Bivalent/Poised TSS Bivalent Enhancer Genic enhancers Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	6 gene(s)	inside rSNPs	diseases
5	nsv917043	chr8:53299833-53856743	Bivalent/Poised TSS Enhancers Flanking Active TSS Weak transcription Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Strong transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
6	nsv917309	chr8:53299908-53898571	Enhancers Weak transcription Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh Active TSS Bivalent/Poised TSS Genic enhancers Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	21 gene(s)	inside rSNPs	diseases
7	nsv1016949	chr8:53300989-53530814	Active TSS Bivalent/Poised TSS Enhancers Strong transcription Flanking Bivalent TSS/Enh Weak transcription Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
8	nsv1026748	chr8:53300989-53917456	Flanking Bivalent TSS/Enh Flanking Active TSS Strong transcription Enhancers Weak transcription Bivalent/Poised TSS Bivalent Enhancer Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
9	nsv1034284	chr8:53302090-53919610	Enhancers Weak transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Flanking Active TSS Bivalent/Poised TSS Strong transcription Active TSS Genic enhancers ZNF genes & repeats Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
10	nsv429915	chr8:53318647-53603847	Bivalent Enhancer Enhancers Strong transcription Weak transcription Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	6 gene(s)	inside rSNPs	diseases
11	nsv1019365	chr8:53320911-53560068	Weak transcription Active TSS Enhancers Bivalent/Poised TSS Strong transcription Genic enhancers Flanking Bivalent TSS/Enh Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	6 gene(s)	inside rSNPs	diseases
12	nsv539610	chr8:53320911-53560068	Bivalent Enhancer Active TSS Weak transcription Enhancers Genic enhancers Strong transcription Bivalent/Poised TSS ZNF genes & repeats Flanking Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	6 gene(s)	inside rSNPs	diseases
13	nsv1019641	chr8:53320911-53917456	Weak transcription Flanking Active TSS Bivalent Enhancer Strong transcription Enhancers Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
14	nsv539611	chr8:53320911-53917456	Genic enhancers Enhancers Weak transcription Flanking Bivalent TSS/Enh Strong transcription Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
15	nsv890902	chr8:53330582-53949560	Weak transcription Strong transcription Enhancers ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS Active TSS Transcr. at gene 5' and 3' Flanking Active TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
16	nsv1032726	chr8:53332059-53766425	Enhancers Weak transcription Active TSS Strong transcription ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
17	nsv539612	chr8:53332059-53766425	Bivalent Enhancer Weak transcription Active TSS Strong transcription Enhancers Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
18	nsv1017736	chr8:53332059-53856829	Weak transcription Flanking Active TSS Strong transcription Enhancers ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
19	nsv539613	chr8:53332059-53856829	Bivalent Enhancer Enhancers Strong transcription Flanking Bivalent TSS/Enh ZNF genes & repeats Weak transcription Flanking Active TSS Active TSS Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
20	nsv949330	chr8:53334349-53603859	Strong transcription Bivalent Enhancer ZNF genes & repeats Weak transcription Enhancers Flanking Bivalent TSS/Enh Active TSS Genic enhancers Flanking Active TSS Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	6 gene(s)	inside rSNPs	diseases
21	nsv890903	chr8:53342616-53528204	Enhancers Bivalent Enhancer Active TSS Bivalent/Poised TSS Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Strong transcription ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
22	nsv1017130	chr8:53352941-53861955	Weak transcription Flanking Bivalent TSS/Enh Active TSS Enhancers Strong transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
23	nsv1033618	chr8:53358820-53824589	Weak transcription Enhancers Active TSS Bivalent/Poised TSS Bivalent Enhancer Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
24	nsv539614	chr8:53358820-53824589	Strong transcription Enhancers Flanking Active TSS Active TSS Weak transcription Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
25	nsv1019474	chr8:53358820-53855933	Enhancers Weak transcription Strong transcription Bivalent/Poised TSS Active TSS Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
26	nsv539615	chr8:53358820-53855933	Strong transcription Active TSS Enhancers Weak transcription Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
27	nsv1023921	chr8:53358820-53917456	Enhancers Weak transcription Bivalent/Poised TSS Bivalent Enhancer Strong transcription Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3' Active TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
28	nsv539616	chr8:53358820-53917456	Weak transcription Enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Strong transcription ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
29	esv2764065	chr8:53364649-53887932	Weak transcription Strong transcription Enhancers Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS ZNF genes & repeats Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	20 gene(s)	inside rSNPs	diseases
30	nsv890904	chr8:53388439-53727578	Active TSS Weak transcription Enhancers Strong transcription Bivalent Enhancer ZNF genes & repeats Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
31	nsv1023704	chr8:53389814-53832663	Weak transcription Strong transcription Enhancers Flanking Active TSS Active TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
32	nsv1031166	chr8:53401100-53594236	Strong transcription Weak transcription Flanking Bivalent TSS/Enh Enhancers Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Active TSS ZNF genes & repeats Flanking Active TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	2 gene(s)	inside rSNPs	diseases
33	nsv1022250	chr8:53401100-53790746	Flanking Active TSS Weak transcription Active TSS Enhancers Strong transcription Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
34	nsv611355	chr8:53402811-53689112	Flanking Active TSS Strong transcription Enhancers Active TSS Weak transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
35	nsv890905	chr8:53406508-53768651	Weak transcription Strong transcription Enhancers Active TSS Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Genic enhancers Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
36	nsv1028813	chr8:53407713-53471832	Active TSS Weak transcription Enhancers Bivalent/Poised TSS Flanking Active TSS Flanking Bivalent TSS/Enh Bivalent Enhancer Strong transcription Genic enhancers ZNF genes & repeats	Chromatin interactive region	n/a	inside rSNPs	diseases
37	nsv1017527	chr8:53407713-53492861	Bivalent Enhancer Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Enhancers Weak transcription Bivalent/Poised TSS ZNF genes & repeats Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
38	nsv890906	chr8:53408434-53491159	Bivalent Enhancer Bivalent/Poised TSS Enhancers Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Genic enhancers Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
39	nsv890907	chr8:53408434-53528204	Enhancers Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Weak transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Active TSS ZNF genes & repeats Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
40	nsv465680	chr8:53416951-53505755	Bivalent Enhancer Flanking Bivalent TSS/Enh Weak transcription Bivalent/Poised TSS Enhancers Active TSS Strong transcription Flanking Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
41	nsv470213	chr8:53416951-53505755	Active TSS Bivalent Enhancer Flanking Active TSS Bivalent/Poised TSS Enhancers Flanking Bivalent TSS/Enh Weak transcription ZNF genes & repeats Transcr. at gene 5' and 3' Genic enhancers Strong transcription	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
42	nsv611356	chr8:53416951-53505755	Enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Bivalent Enhancer Weak transcription Genic enhancers Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region	1 gene(s)	inside rSNPs	diseases
43	nsv915643	chr8:53426209-53734930	Weak transcription Strong transcription Enhancers Flanking Active TSS Bivalent Enhancer Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
44	nsv1028061	chr8:53433836-53748168	Weak transcription ZNF genes & repeats Strong transcription Active TSS Enhancers Bivalent/Poised TSS Flanking Active TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
45	nsv1020817	chr8:53433836-53790746	Weak transcription Enhancers ZNF genes & repeats Genic enhancers Strong transcription Flanking Bivalent TSS/Enh Flanking Active TSS Active TSS Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	16 gene(s)	inside rSNPs	diseases
46	esv3325871	chr8:53438299-53440247	Weak transcription	n/a	n/a	inside rSNPs	diseases

No data

Chromatin state (count:1 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr8:53436400-53444000	Weak transcription	IMR90 fetal lung fibroblasts Cell Line	lung

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links