Variant report

Variant	rs61571350
Chromosome Location	chr10:1103265-1103266
allele	-/CCCGGGGCGGCGCTGGAGGG
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

TF binding
region (count:0)
CpG islands
(count:0)
Chromatin interactive
region (count:12)
LncRNA
region (count:0)
Mature miRNA
region (count: 0)
miRNA target
sites (count:0)

No data

(count:12 , 50 per page) page: 1

No.	Distal block	Cell Line	Cell type
1	chr10:1031887..1035944-chr10:1099515..1103666,8	MCF-7	breast:
2	chr10:1090197..1098635-chr10:1098667..1108160,39	K562	blood:
3	chr10:1034367..1036220-chr10:1101305..1103834,2	MCF-7	breast:
4	chr10:1041791..1044346-chr10:1102809..1104842,2	MCF-7	breast:
5	chr10:1033196..1035740-chr10:1100283..1103390,4	K562	blood:
6	chr10:1031711..1035740-chr10:1100728..1103796,4	K562	blood:
7	chr10:1101227..1103442-chr17:57918099..57920735,2	MCF-7	breast:
8	chr10:974670..978531-chr10:1101117..1104171,5	K562	blood:
9	chr10:1100725..1104850-chr10:1118585..1122154,6	K562	blood:
10	chr10:1101511..1104003-chr10:3108866..3111744,3	MCF-7	breast:
11	chr10:975998..978434-chr10:1103106..1105638,3	MCF-7	breast:
12	chr10:1100859..1106350-chr10:1117983..1126025,11	MCF-7	breast:

No data

Variant related genes	Relation type
ENSG00000067064	Chromatin interaction
ENSG00000199004	Chromatin interaction
ENSG00000067057	Chromatin interaction
ENSG00000205740	Chromatin interaction
ENSG00000107929	Chromatin interaction
ENSG00000107937	Chromatin interaction
ENSG00000047056	Chromatin interaction

Extended variants
information (count: 61 )
Associated
traits (count: 0)

rSNPs within LD-proxies of this variant (count:40)

rs_ID	r²[population]
rs10047269	1.00[AMR][1000 genomes];1.00[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs10047382	1.00[AMR][1000 genomes];1.00[EUR][1000 genomes];0.82[ASN][1000 genomes]
rs10047383	0.87[AMR][1000 genomes];0.88[EUR][1000 genomes]
rs10219038	0.87[AMR][1000 genomes];0.94[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs1079389	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs1079390	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs10794720	0.92[EUR][1000 genomes]
rs11250242	0.97[AMR][1000 genomes];0.96[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs11250249	0.87[EUR][1000 genomes]
rs11250252	0.87[AMR][1000 genomes];0.94[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs11250264	0.87[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs11815047	0.84[ASN][1000 genomes]
rs11816485	0.87[AMR][1000 genomes];0.89[EUR][1000 genomes]
rs11818314	0.81[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs11819178	0.97[AMR][1000 genomes];0.91[EUR][1000 genomes];0.91[ASN][1000 genomes]
rs11819230	0.87[AMR][1000 genomes];0.94[EUR][1000 genomes];0.89[ASN][1000 genomes]
rs12247779	0.85[EUR][1000 genomes];0.85[ASN][1000 genomes]
rs12247818	1.00[AMR][1000 genomes];0.95[EUR][1000 genomes];0.91[ASN][1000 genomes]
rs12250141	0.89[EUR][1000 genomes]
rs12268949	1.00[AMR][1000 genomes];1.00[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs12359250	0.91[ASN][1000 genomes]
rs17155886	0.87[AMR][1000 genomes];0.90[EUR][1000 genomes]
rs2279256	0.84[AMR][1000 genomes];0.94[EUR][1000 genomes];0.88[ASN][1000 genomes]
rs2387299	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs2892254	0.89[ASN][1000 genomes]
rs3886474	0.83[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs41299206	0.87[AMR][1000 genomes];0.87[EUR][1000 genomes];0.87[ASN][1000 genomes]
rs56004802	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs57514701	0.87[AMR][1000 genomes];0.94[EUR][1000 genomes]
rs59377495	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs7071670	1.00[AMR][1000 genomes];1.00[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs7075830	0.83[AMR][1000 genomes];0.81[ASN][1000 genomes]
rs7093915	0.83[AFR][1000 genomes];1.00[AMR][1000 genomes];0.96[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs7100114	0.97[AMR][1000 genomes];0.98[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs74117685	0.92[EUR][1000 genomes]
rs74117831	0.87[AMR][1000 genomes];0.94[EUR][1000 genomes]
rs74117848	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs74117849	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs74117850	0.80[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs74120451	0.87[AMR][1000 genomes];0.94[EUR][1000 genomes];0.93[ASN][1000 genomes]

Variant overlapped rSNPs/rCNVs (count:21 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv540386	chr10:224406-1197416	Active TSS Weak transcription Enhancers Strong transcription Flanking Active TSS ZNF genes & repeats Genic enhancers Transcr. at gene 5' and 3' Bivalent Enhancer Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	51 gene(s)	inside rSNPs	diseases
2	nsv1054659	chr10:611444-1133578	Weak transcription Enhancers Flanking Active TSS Bivalent Enhancer Strong transcription Genic enhancers Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	43 gene(s)	inside rSNPs	diseases
3	nsv466697	chr10:734229-1129527	ZNF genes & repeats Weak transcription Flanking Active TSS Strong transcription Active TSS Bivalent Enhancer Enhancers Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	39 gene(s)	inside rSNPs	diseases
4	nsv549765	chr10:734229-1129527	Genic enhancers Enhancers Active TSS Flanking Active TSS ZNF genes & repeats Weak transcription Strong transcription Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	39 gene(s)	inside rSNPs	diseases
5	nsv530116	chr10:776548-1401075	Weak transcription Enhancers Strong transcription Genic enhancers Flanking Active TSS Active TSS ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	41 gene(s)	inside rSNPs	diseases
6	nsv1052540	chr10:887562-1300134	Strong transcription Weak transcription Enhancers Active TSS Genic enhancers ZNF genes & repeats Flanking Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	34 gene(s)	inside rSNPs	diseases
7	nsv540407	chr10:887562-1300134	Weak transcription Enhancers Active TSS Strong transcription Flanking Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	34 gene(s)	inside rSNPs	diseases
8	nsv533861	chr10:945438-1382068	Enhancers Weak transcription Strong transcription Active TSS Flanking Active TSS Genic enhancers Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	34 gene(s)	inside rSNPs	diseases
9	nsv530117	chr10:945438-1729634	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3' Active TSS Strong transcription Genic enhancers Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
10	nsv540408	chr10:955835-1260680	Enhancers Transcr. at gene 5' and 3' Strong transcription ZNF genes & repeats Genic enhancers Active TSS Weak transcription Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	34 gene(s)	inside rSNPs	diseases
11	nsv817532	chr10:964660-1885945	Bivalent/Poised TSS Enhancers Strong transcription Flanking Active TSS Active TSS Weak transcription Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
12	nsv1050577	chr10:986723-1277854	Weak transcription Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Active TSS Enhancers Genic enhancers Bivalent/Poised TSS Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	30 gene(s)	inside rSNPs	diseases
13	nsv540409	chr10:986723-1277854	Weak transcription Strong transcription Enhancers ZNF genes & repeats Flanking Active TSS Genic enhancers Bivalent Enhancer Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	30 gene(s)	inside rSNPs	diseases
14	nsv949405	chr10:1010464-1376105	Weak transcription Active TSS Bivalent/Poised TSS Strong transcription Flanking Active TSS Enhancers Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	30 gene(s)	inside rSNPs	diseases
15	nsv1048254	chr10:1016006-1146595	Weak transcription Enhancers Strong transcription Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Active TSS ZNF genes & repeats Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	26 gene(s)	inside rSNPs	diseases
16	nsv1040178	chr10:1024910-1126104	Strong transcription Active TSS Flanking Active TSS Enhancers Genic enhancers Weak transcription Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
17	nsv540410	chr10:1024910-1126104	Enhancers Genic enhancers Transcr. at gene 5' and 3' Flanking Active TSS Weak transcription Strong transcription Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	26 gene(s)	inside rSNPs	diseases
18	nsv894722	chr10:1058837-1274538	Strong transcription Enhancers Weak transcription Active TSS Genic enhancers Flanking Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	25 gene(s)	inside rSNPs	diseases
19	nsv1046220	chr10:1064024-1188998	Active TSS Enhancers Weak transcription Strong transcription Genic enhancers Flanking Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	22 gene(s)	inside rSNPs	diseases
20	nsv894723	chr10:1073684-1259485	Enhancers Weak transcription Genic enhancers Active TSS Strong transcription Flanking Active TSS Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	24 gene(s)	inside rSNPs	diseases
21	nsv894724	chr10:1084942-1116294	Flanking Active TSS Genic enhancers Active TSS Weak transcription Enhancers Strong transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	19 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:127 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr10:1100000-1103800	Active TSS	Foreskin Melanocyte Primary Cells skin01	Skin
2	chr10:1100800-1104400	Active TSS	Foreskin Fibroblast Primary Cells skin02	Skin
3	chr10:1101000-1103600	Active TSS	ES-I3 Cell Line	embryonic stem cell
4	chr10:1101000-1103600	Active TSS	iPS-18 Cell Line	embryonic stem cell
5	chr10:1101000-1103800	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
6	chr10:1101000-1103800	Active TSS	GM12878-XiMat	blood
7	chr10:1101000-1104000	Active TSS	H1 Cell Line	embryonic stem cell
8	chr10:1101000-1104200	Active TSS	IMR90 fetal lung fibroblasts Cell Line	lung
9	chr10:1101200-1103400	Active TSS	HUES6 Cell Line	embryonic stem cell
10	chr10:1101200-1103400	Active TSS	Ganglion Eminence derived primary cultured neurospheres	brain
11	chr10:1101200-1103400	Active TSS	Rectal Mucosa Donor 29	rectum
12	chr10:1101200-1103600	Active TSS	HSMMtube	muscle
13	chr10:1101200-1103800	Active TSS	Psoas Muscle	Psoas
14	chr10:1101200-1103800	Active TSS	Right Ventricle	heart
15	chr10:1101200-1104200	Active TSS	iPS-20b Cell Line	embryonic stem cell
16	chr10:1101200-1104400	Active TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
17	chr10:1101200-1104400	Active TSS	Right Atrium	heart
18	chr10:1101400-1103400	Active TSS	Rectal Smooth Muscle	rectum
19	chr10:1101400-1103600	Active TSS	HMEC	breast
20	chr10:1101400-1103600	Active TSS	HSMM	muscle
21	chr10:1101400-1103600	Active TSS	NHDF-Ad	bronchial
22	chr10:1101400-1103800	Active TSS	NHLF	lung
23	chr10:1101400-1104000	Active TSS	A549	lung
24	chr10:1101400-1104000	Active TSS	HepG2	liver
25	chr10:1101400-1104200	Active TSS	HUES64 Cell Line	embryonic stem cell
26	chr10:1101400-1104400	Active TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
27	chr10:1101600-1103400	Active TSS	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
28	chr10:1101600-1103400	Active TSS	H9 Derived Neuron Cultured Cells	ES cell derived
29	chr10:1101600-1103400	Active TSS	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
30	chr10:1101600-1103400	Active TSS	Breast Myoepithelial Primary Cells	Breast
31	chr10:1101600-1103400	Active TSS	Breast variant Human Mammary Epithelial Cells (vHMEC)	Breast
32	chr10:1101600-1103400	Active TSS	Primary monocytes fromperipheralblood	blood
33	chr10:1101600-1103400	Active TSS	Primary T killer memory cells from peripheral blood	blood
34	chr10:1101600-1103400	Active TSS	Muscle Satellite Cultured Cells	--
35	chr10:1101600-1103400	Active TSS	Foreskin Fibroblast Primary Cells skin01	Skin
36	chr10:1101600-1103400	Active TSS	Brain Cingulate Gyrus	brain
37	chr10:1101600-1103400	Active TSS	Brain Dorsolateral Prefrontal Cortex	brain
38	chr10:1101600-1103400	Active TSS	Colon Smooth Muscle	Colon
39	chr10:1101600-1103400	Active TSS	Duodenum Mucosa	Duodenum
40	chr10:1101600-1103400	Active TSS	Pancreas	Pancrea
41	chr10:1101600-1103400	Active TSS	Placenta Amnion	Placenta Amnion
42	chr10:1101600-1103400	Active TSS	Rectal Mucosa Donor 31	rectum
43	chr10:1101600-1103400	Active TSS	Dnd41	blood
44	chr10:1101600-1103400	Active TSS	Hela-S3	cervix
45	chr10:1101600-1103400	Active TSS	HUVEC	blood vessel
46	chr10:1101600-1103400	Active TSS	NHEK	skin
47	chr10:1101600-1103400	Active TSS	Osteobl	bone
48	chr10:1101600-1103600	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
49	chr10:1101600-1103600	Active TSS	iPS-15b Cell Line	embryonic stem cell
50	chr10:1101600-1103600	Active TSS	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links