Variant report

Variant rs369220104
Chromosome Location chr6:33755004-33755005
allele -/AAAGCATCTCAGCAGTGAGTA
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr6:33751600-33755200 Genic enhancers Primary T helper memory cells from peripheral blood 2 blood
2 chr6:33752600-33755200 Genic enhancers Foreskin Melanocyte Primary Cells skin03 Skin
3 chr6:33752600-33755600 Genic enhancers Primary Natural Killer cells fromperipheralblood blood
4 chr6:33752800-33755200 Genic enhancers Brain Hippocampus Middle brain
5 chr6:33752800-33755400 Enhancers hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
6 chr6:33752800-33755400 Genic enhancers Fetal Muscle Leg muscle
7 chr6:33752800-33755400 Genic enhancers Placenta Placenta
8 chr6:33753000-33755200 Genic enhancers H9 Derived Neuronal Progenitor Cultured Cells ES cell derived
9 chr6:33753000-33755200 Genic enhancers Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
10 chr6:33753000-33755200 Genic enhancers Primary hematopoietic stem cells G-CSF-mobilized Female --
11 chr6:33753000-33755200 Genic enhancers HSMM muscle
12 chr6:33753000-33755400 Genic enhancers Primary B cells from peripheral blood blood
13 chr6:33753000-33756000 Flanking Active TSS HUVEC blood vessel
14 chr6:33753200-33755200 Genic enhancers Fetal Stomach stomach
15 chr6:33753200-33755200 Genic enhancers Thymus Thymus
16 chr6:33753200-33755400 Enhancers Fetal Heart heart
17 chr6:33753200-33755400 Enhancers Right Ventricle heart
18 chr6:33753200-33755600 Flanking Active TSS ES-I3 Cell Line embryonic stem cell
19 chr6:33753400-33755200 Weak transcription H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
20 chr6:33753400-33755200 Enhancers Foreskin Melanocyte Primary Cells skin01 Skin
21 chr6:33753400-33755200 Weak transcription Esophagus oesophagus
22 chr6:33753400-33755400 Strong transcription Fetal Muscle Trunk muscle
23 chr6:33753400-33755600 Weak transcription iPS DF 19.11 Cell Line embryonic stem cell
24 chr6:33753400-33755800 Enhancers Spleen Spleen
25 chr6:33753600-33755200 Enhancers Primary T cells effector/memory enriched fromperipheralblood blood
26 chr6:33753600-33755200 Genic enhancers Brain Angular Gyrus brain
27 chr6:33753600-33755200 Enhancers Skeletal Muscle Male skeletal muscle
28 chr6:33753600-33755200 Enhancers HSMMtube muscle
29 chr6:33753600-33755400 Enhancers ES-UCSF4 Cell Line embryonic stem cell
30 chr6:33753600-33755400 Genic enhancers Primary hematopoietic stem cells short term culture blood
31 chr6:33753600-33755400 Enhancers Primary T helper memory cells from peripheral blood 1 blood
32 chr6:33753800-33755200 Enhancers Rectal Mucosa Donor 31 rectum
33 chr6:33753800-33755400 Enhancers Stomach Mucosa stomach
34 chr6:33753800-33755600 Enhancers Small Intestine intestine
35 chr6:33753800-33755800 Flanking Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
36 chr6:33754000-33755200 Enhancers H1 Cell Line embryonic stem cell
37 chr6:33754000-33755200 Genic enhancers H9 Derived Neuron Cultured Cells ES cell derived
38 chr6:33754000-33755200 Genic enhancers Primary B cells from cord blood blood
39 chr6:33754000-33755200 Enhancers Brain Germinal Matrix brain
40 chr6:33754000-33755200 Enhancers Colonic Mucosa Colon
41 chr6:33754000-33755400 Genic enhancers Fetal Thymus thymus
42 chr6:33754000-33755800 Enhancers H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
43 chr6:33754000-33756000 Flanking Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
44 chr6:33754200-33755200 Weak transcription H9 Cell Line embryonic stem cell
45 chr6:33754200-33755200 Enhancers hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
46 chr6:33754200-33755200 Genic enhancers Brain Inferior Temporal Lobe brain
47 chr6:33754200-33755400 Enhancers Primary neutrophils fromperipheralblood blood
48 chr6:33754200-33755400 Enhancers Cortex derived primary cultured neurospheres brain
49 chr6:33754200-33755400 Enhancers Psoas Muscle Psoas
50 chr6:33754200-33756400 Transcr. at gene 5' and 3' Dnd41 blood

Quick Search:


  
Input of quick search could be:

what's new

Quick links