Variant report

Variant	rs535163869
Chromosome Location	chr19:52131854-52131855
allele	-/GGGTGTACGTACATGTGTGCGTGTGT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

No.	Distal block	Cell Line	Cell type	Cell Stage
1	chr19:52123766..52126647-chr19:52131236..52133976,2	K562	blood:
2	chr19:52127522..52129415-chr19:52131096..52132777,2	K562	blood:

Variant related genes	Relation type
ENSG00000244071	Chromatin interaction

Extended variants
information (count: 41 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:41 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv544051	chr19:51944903-52147459	Bivalent Enhancer Strong transcription Weak transcription Active TSS ZNF genes & repeats Flanking Active TSS Enhancers Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	26 gene(s)	inside rSNPs	diseases
2	esv2758504	chr19:51991896-52266700	Enhancers Strong transcription Transcr. at gene 5' and 3' Weak transcription Active TSS ZNF genes & repeats Flanking Active TSS Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	542 gene(s)	inside rSNPs	diseases
3	esv2758767	chr19:51991896-52604625	Flanking Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Weak transcription Active TSS Bivalent/Poised TSS Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	578 gene(s)	inside rSNPs	diseases
4	nsv469584	chr19:52001381-52151821	Enhancers Weak transcription Flanking Active TSS ZNF genes & repeats Active TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription Flanking Bivalent TSS/Enh Bivalent Enhancer Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	25 gene(s)	inside rSNPs	diseases
5	nsv482654	chr19:52001381-52151821	Enhancers Strong transcription Weak transcription Bivalent Enhancer Active TSS Flanking Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	25 gene(s)	inside rSNPs	diseases
6	nsv482909	chr19:52091735-52266700	Flanking Active TSS Enhancers Weak transcription Active TSS Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Bivalent/Poised TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	533 gene(s)	inside rSNPs	diseases
7	nsv510771	chr19:52103717-52153348	Enhancers Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Strong transcription Flanking Active TSS Genic enhancers Bivalent/Poised TSS Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	11 gene(s)	inside rSNPs	diseases
8	nsv1064914	chr19:52103914-52231564	Transcr. at gene 5' and 3' Enhancers Weak transcription Bivalent Enhancer Strong transcription Bivalent/Poised TSS Active TSS Genic enhancers Flanking Bivalent TSS/Enh Flanking Active TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA	529 gene(s)	inside rSNPs	diseases
9	nsv544052	chr19:52103914-52271247	Enhancers Bivalent Enhancer Weak transcription Active TSS Flanking Active TSS Genic enhancers Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA	531 gene(s)	inside rSNPs	diseases
10	nsv1056825	chr19:52103914-52359815	Active TSS Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	541 gene(s)	inside rSNPs	diseases
11	nsv544053	chr19:52103914-52359815	ZNF genes & repeats Flanking Active TSS Active TSS Strong transcription Enhancers Flanking Bivalent TSS/Enh Bivalent/Poised TSS Weak transcription Transcr. at gene 5' and 3' Genic enhancers Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA	541 gene(s)	inside rSNPs	diseases
12	nsv1065410	chr19:52103914-52889530	Genic enhancers Enhancers ZNF genes & repeats Weak transcription Strong transcription Active TSS Flanking Active TSS Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	596 gene(s)	inside rSNPs	diseases
13	nsv2532	chr19:52109105-52186946	Weak transcription Active TSS Strong transcription Enhancers Flanking Active TSS Bivalent Enhancer Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
14	nsv181	chr19:52113123-52162533	Strong transcription Enhancers Flanking Active TSS Genic enhancers Weak transcription Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	10 gene(s)	inside rSNPs	diseases
15	esv1827143	chr19:52119456-52154871	Active TSS Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Weak transcription Enhancers Genic enhancers Bivalent Enhancer Transcr. at gene 5' and 3' Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
16	esv1847752	chr19:52119456-52154871	Enhancers Active TSS Flanking Bivalent TSS/Enh Flanking Active TSS Bivalent/Poised TSS Weak transcription Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
17	esv1846813	chr19:52119490-52158241	Weak transcription ZNF genes & repeats Enhancers Bivalent Enhancer Genic enhancers Bivalent/Poised TSS Strong transcription Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
18	nsv912295	chr19:52119546-52152017	Bivalent Enhancer Enhancers Weak transcription Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS Flanking Active TSS Genic enhancers Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
19	nsv458725	chr19:52123549-52155449	Enhancers Weak transcription Flanking Active TSS Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh Active TSS Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
20	nsv579967	chr19:52123549-52155449	Weak transcription Flanking Active TSS Enhancers Bivalent Enhancer Active TSS ZNF genes & repeats Strong transcription Genic enhancers Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
21	esv3496949	chr19:52125665-52135420	Enhancers Strong transcription Flanking Active TSS Active TSS Genic enhancers Weak transcription Transcr. at gene 5' and 3' Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
22	esv3496950	chr19:52125669-52135418	Active TSS Strong transcription Enhancers Weak transcription ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Active TSS Genic enhancers Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
23	nsv1056104	chr19:52127030-52154905	Flanking Active TSS Weak transcription Active TSS Enhancers Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
24	nsv1057374	chr19:52127053-52154905	Flanking Active TSS Weak transcription Enhancers Bivalent Enhancer Strong transcription Active TSS ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
25	nsv432071	chr19:52127053-52182363	Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent/Poised TSS Strong transcription Genic enhancers Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	9 gene(s)	inside rSNPs	diseases
26	esv2760513	chr19:52127271-52148197	Weak transcription Enhancers Active TSS ZNF genes & repeats Flanking Active TSS Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
27	esv3371264	chr19:52129189-52148980	Active TSS Enhancers Weak transcription Flanking Active TSS Bivalent/Poised TSS Bivalent Enhancer Genic enhancers ZNF genes & repeats Strong transcription Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
28	esv3392047	chr19:52129840-52134038	Weak transcription ZNF genes & repeats Transcr. at gene 5' and 3' Strong transcription Enhancers Active TSS Bivalent/Poised TSS Flanking Active TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	2 gene(s)	inside rSNPs	diseases
29	nsv1058762	chr19:52129854-52158855	Weak transcription Enhancers Active TSS Flanking Active TSS Transcr. at gene 5' and 3' Bivalent Enhancer ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Strong transcription Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
30	nsv579969	chr19:52130488-52158393	Enhancers Bivalent Enhancer Active TSS Flanking Active TSS Weak transcription ZNF genes & repeats Strong transcription Bivalent/Poised TSS Genic enhancers Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
31	nsv579970	chr19:52131119-52148804	Bivalent/Poised TSS Enhancers ZNF genes & repeats Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
32	esv1845561	chr19:52131510-52153764	Bivalent Enhancer Enhancers Flanking Active TSS Strong transcription Weak transcription Genic enhancers Bivalent/Poised TSS Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
33	esv1843680	chr19:52131510-52211749	Active TSS Flanking Active TSS Genic enhancers Enhancers Weak transcription Transcr. at gene 5' and 3' ZNF genes & repeats Bivalent/Poised TSS Strong transcription Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA	525 gene(s)	inside rSNPs	diseases
34	esv1832980	chr19:52131618-52148534	Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Bivalent/Poised TSS Enhancers Genic enhancers Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent Enhancer Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
35	esv1850294	chr19:52131618-52148534	Enhancers Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Active TSS Genic enhancers Transcr. at gene 5' and 3' Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	5 gene(s)	inside rSNPs	diseases
36	nsv1064047	chr19:52131624-52157403	Weak transcription Flanking Active TSS Enhancers Active TSS Strong transcription Bivalent Enhancer Genic enhancers ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
37	nsv1062399	chr19:52131624-52157425	Bivalent/Poised TSS Enhancers Genic enhancers Weak transcription Active TSS Bivalent Enhancer Flanking Active TSS Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3' Strong transcription	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
38	nsv1055268	chr19:52131624-52158855	ZNF genes & repeats Weak transcription Enhancers Active TSS Strong transcription Flanking Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
39	esv3318825	chr19:52131740-52151838	Enhancers Weak transcription Bivalent Enhancer Active TSS Bivalent/Poised TSS Flanking Active TSS Genic enhancers Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases
40	nsv828588	chr19:52131749-52149103	Enhancers Flanking Active TSS Active TSS Weak transcription Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Bivalent Enhancer Strong transcription Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	6 gene(s)	inside rSNPs	diseases
41	esv20603	chr19:52131804-52150223	Active TSS Flanking Active TSS Enhancers ZNF genes & repeats Weak transcription Strong transcription Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	7 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:25 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr19:52125000-52133600	Weak transcription	Primary hematopoietic stem cells	blood
2	chr19:52127800-52132400	Transcr. at gene 5' and 3'	Primary neutrophils fromperipheralblood	blood
3	chr19:52128800-52133800	Weak transcription	Primary hematopoietic stem cells G-CSF-mobilized Female	--
4	chr19:52129800-52132400	Genic enhancers	Primary B cells from peripheral blood	blood
5	chr19:52129800-52132400	Genic enhancers	Primary hematopoietic stem cells short term culture	blood
6	chr19:52130200-52132400	Weak transcription	Right Atrium	heart
7	chr19:52130400-52132400	Transcr. at gene 5' and 3'	Monocytes-CD14+_RO01746	blood
8	chr19:52130400-52132600	ZNF genes & repeats	H1 BMP4 Derived Trophoblast Cultured Cells	ES cell derived
9	chr19:52130800-52132400	Enhancers	Primary Natural Killer cells fromperipheralblood	blood
10	chr19:52130800-52133200	Weak transcription	Gastric	stomach
11	chr19:52131000-52133800	Weak transcription	ES-UCSF4 Cell Line	embryonic stem cell
12	chr19:52131000-52134000	Weak transcription	Primary mononuclear cells fromperipheralblood	Blood
13	chr19:52131400-52132200	ZNF genes & repeats	H1 Cell Line	embryonic stem cell
14	chr19:52131400-52132200	ZNF genes & repeats	Spleen	Spleen
15	chr19:52131400-52132400	Bivalent Enhancer	Primary hematopoietic stem cells G-CSF-mobilized Male	--
16	chr19:52131400-52132600	Transcr. at gene 5' and 3'	Primary monocytes fromperipheralblood	blood
17	chr19:52131600-52132200	ZNF genes & repeats	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
18	chr19:52131600-52132200	Transcr. at gene 5' and 3'	Primary B cells from cord blood	blood
19	chr19:52131800-52132000	Flanking Bivalent TSS/Enh	Skeletal Muscle Male	skeletal muscle
20	chr19:52131800-52132200	ZNF genes & repeats	H1 Derived Mesenchymal Stem Cells	ES cell derived
21	chr19:52131800-52132200	ZNF genes & repeats	iPS DF 19.11 Cell Line	embryonic stem cell
22	chr19:52131800-52132200	Bivalent Enhancer	Adipose Nuclei	Adipose
23	chr19:52131800-52132200	Bivalent/Poised TSS	Fetal Lung	lung
24	chr19:52131800-52132200	Bivalent/Poised TSS	Skeletal Muscle Female	skeletal muscle
25	chr19:52131800-52132200	Enhancers	GM12878-XiMat	blood

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links