Variant report

Variant	rs571204900
Chromosome Location	chr6:76154878-76154879
allele	-/TTCAAAGCTCTTAGAAAAATATT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 12 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:12 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv1016804	chr6:75775846-76188585	Enhancers Weak transcription Strong transcription ZNF genes & repeats Active TSS Flanking Bivalent TSS/Enh Bivalent/Poised TSS Genic enhancers Flanking Active TSS Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
2	nsv538310	chr6:75775846-76188585	Flanking Active TSS Active TSS Weak transcription Enhancers Bivalent Enhancer Bivalent/Poised TSS Strong transcription Flanking Bivalent TSS/Enh Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	38 gene(s)	inside rSNPs	diseases
3	nsv1024079	chr6:75848556-76238519	Enhancers Flanking Active TSS Weak transcription Active TSS Bivalent Enhancer ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	39 gene(s)	inside rSNPs	diseases
4	nsv1027915	chr6:75893542-76510113	Active TSS Enhancers Strong transcription Bivalent Enhancer Weak transcription Flanking Bivalent TSS/Enh Flanking Active TSS Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	70 gene(s)	inside rSNPs	diseases
5	nsv538311	chr6:75893542-76510113	Weak transcription Enhancers Flanking Active TSS Flanking Bivalent TSS/Enh Active TSS Strong transcription Bivalent/Poised TSS Genic enhancers Bivalent Enhancer ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	70 gene(s)	inside rSNPs	diseases
6	nsv1022428	chr6:76023118-76575620	Weak transcription Strong transcription Enhancers Flanking Active TSS Active TSS Genic enhancers ZNF genes & repeats Bivalent/Poised TSS Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	48 gene(s)	inside rSNPs	diseases
7	nsv538312	chr6:76023118-76575620	Weak transcription Enhancers Bivalent Enhancer Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Active TSS Genic enhancers Flanking Bivalent TSS/Enh ZNF genes & repeats Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA	48 gene(s)	inside rSNPs	diseases
8	nsv1032245	chr6:76045537-76545703	Enhancers Weak transcription Strong transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS Genic enhancers Bivalent Enhancer Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	47 gene(s)	inside rSNPs	diseases
9	nsv538313	chr6:76045537-76545703	Strong transcription Weak transcription Enhancers Active TSS Bivalent/Poised TSS Flanking Active TSS ZNF genes & repeats Genic enhancers Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA	47 gene(s)	inside rSNPs	diseases
10	nsv886182	chr6:76096230-76194007	Active TSS Weak transcription Enhancers Genic enhancers Flanking Active TSS Bivalent Enhancer Strong transcription ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA miRNA	7 gene(s)	inside rSNPs	diseases
11	nsv1019328	chr6:76154751-76604197	Enhancers Weak transcription Strong transcription Active TSS Bivalent/Poised TSS Flanking Active TSS Genic enhancers ZNF genes & repeats Bivalent Enhancer Transcr. at gene 5' and 3' Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	44 gene(s)	inside rSNPs	diseases
12	nsv538314	chr6:76154751-76604197	Enhancers Strong transcription Active TSS Weak transcription Genic enhancers Flanking Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	44 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:16 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr6:76146400-76171600	Weak transcription	Right Ventricle	heart
2	chr6:76148000-76156200	Weak transcription	Aorta	Aorta
3	chr6:76148400-76173600	Weak transcription	Stomach Smooth Muscle	stomach
4	chr6:76148600-76156200	Weak transcription	Duodenum Smooth Muscle	Duodenum
5	chr6:76148800-76177000	Weak transcription	Fetal Muscle Leg	muscle
6	chr6:76150400-76156200	Weak transcription	Skeletal Muscle Female	skeletal muscle
7	chr6:76150400-76168800	Weak transcription	Skeletal Muscle Male	skeletal muscle
8	chr6:76150600-76156200	Weak transcription	Left Ventricle	heart
9	chr6:76154200-76155200	Enhancers	Colon Smooth Muscle	Colon
10	chr6:76154400-76155400	Enhancers	Rectal Smooth Muscle	rectum
11	chr6:76154600-76155200	Enhancers	IMR90 fetal lung fibroblasts Cell Line	lung
12	chr6:76154600-76155400	Weak transcription	Fetal Heart	heart
13	chr6:76154600-76155600	Enhancers	Fetal Lung	lung
14	chr6:76154800-76155200	Enhancers	Psoas Muscle	Psoas
15	chr6:76154800-76158000	Enhancers	A549	lung
16	chr6:76154800-76159200	Weak transcription	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links