Variant report

Variant	rs57014027
Chromosome Location	chr11:93346918-93346919
allele	-/TAATAAATTAATGAATTTATTGAT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 7 )
Associated
traits (count: 0)

rSNPs within LD-proxies of this variant (count:4)

rs_ID	r²[population]
rs1939573	0.81[ASN][1000 genomes]
rs58018625	0.82[ASN][1000 genomes]
rs67773478	0.82[ASN][1000 genomes]
rs7940754	0.86[ASN][1000 genomes]

Variant overlapped rSNPs/rCNVs (count:3 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv898181	chr11:93072843-93662459	Flanking Active TSS Weak transcription Enhancers Strong transcription Active TSS Transcr. at gene 5' and 3' ZNF genes & repeats Genic enhancers Bivalent Enhancer Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA miRNA target site	119 gene(s)	inside rSNPs	diseases
2	esv3369556	chr11:93346204-93348252	Enhancers Weak transcription	TF binding region	1 gene(s)	inside rSNPs	diseases
3	esv3436454	chr11:93346554-93347752	Enhancers Weak transcription	TF binding region	1 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:4 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr11:93344400-93347600	Enhancers	Fetal Intestine Small	intestine
2	chr11:93344800-93347400	Weak transcription	Gastric	stomach
3	chr11:93346800-93347200	Weak transcription	Duodenum Mucosa	Duodenum
4	chr11:93346800-93347600	Weak transcription	Fetal Intestine Large	intestine

Quick Search:

Input of quick search could be:

dbSNP/dbVar ID: rs12345 /nsv7879
a single nucleotide as 0-based coordinates: chr1:12345
chromosomal regions: chr1:12345-34567

what's new

Quick links