Variant report

Variant	rs57488599
Chromosome Location	chr16:74700743-74700744
allele	CGCCGAAGACTCGGTAGTTACCTCC/G
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

TF binding
region (count:471)
CpG islands
(count:61)
Chromatin interactive
region (count:8)
LncRNA
region (count:0)
Mature miRNA
region (count: 0)
miRNA target
sites (count:0)

(count:471 , 50 per page) page: 1 2 3 4 5 6 7 ... 10

No.	Transcrition factor	Chromosome Location	Cell Line	Cell type	Cell Stage	Matched TF binding sites
1	POLR2A	chr16:74700105-74701535	MCF10A-Er-Src	breast:	n/a	n/a
2	MAFK	chr16:74700696-74701066	IMR90	lung:	n/a	n/a
3	ATF2	chr16:74700475-74700904	H1-hESC	embryonic stem cell:	n/a	n/a
4	REST	chr16:74700285-74701023	HL-60	blood:	n/a	chr16:74700459-74700472
5	HA-E2F1	chr16:74700150-74701799	MCF-7	breast:	n/a	chr16:74700908-74700917 chr16:74701420-74701427 chr16:74701497-74701507 chr16:74701496-74701505 chr16:74700397-74700407
6	SP1	chr16:74700537-74701201	GM12878	blood:	n/a	chr16:74700897-74700918
7	ZBTB7A	chr16:74700276-74700804	K562	blood:	n/a	n/a
8	SP2	chr16:74700569-74701154	H1-hESC	embryonic stem cell:	n/a	chr16:74700906-74700916 chr16:74700966-74700989
9	TEAD4	chr16:74700522-74701662	HepG2	liver:	n/a	n/a
10	YY1	chr16:74700742-74701121	SK-N-SH_RA	brain:	n/a	n/a
11	MAX	chr16:74700133-74701799	HepG2	liver:	n/a	chr16:74700459-74700468
12	CEBPB	chr16:74700695-74700840	H1-hESC	embryonic stem cell:	n/a	n/a
13	CHD1	chr16:74700365-74700816	GM12878	blood:	n/a	n/a
14	TBP	chr16:74700546-74701979	GM12878	blood:	n/a	n/a
15	TAF1	chr16:74700520-74700911	GM12891	blood:	n/a	n/a
16	POLR2A	chr16:74700562-74700874	SK-N-SH	brain:	n/a	n/a
17	FOS	chr16:74700612-74701452	K562	blood:	n/a	chr16:74700906-74700915
18	MAX	chr16:74700180-74701230	HepG2	liver:	n/a	chr16:74700459-74700468
19	TAF1	chr16:74700577-74700917	H1-neurons	neurons:	n/a	n/a
20	POLR2A	chr16:74700566-74700851	A549	lung:	n/a	n/a
21	POLR2A	chr16:74700061-74701232	GM12878	blood:	n/a	n/a
22	POLR2A	chr16:74700417-74701464	PANC-1	pancreas:	n/a	n/a
23	TEAD4	chr16:74700637-74701016	A549	lung:	n/a	n/a
24	POLR2A	chr16:74700261-74700927	GM12878	blood:	n/a	n/a
25	MAX	chr16:74700256-74701604	Hela-S3	cervix:	n/a	chr16:74700459-74700468
26	POLR2A	chr16:74700181-74701009	GM12892	blood:	n/a	n/a
27	TEAD4	chr16:74700467-74701742	K562	blood:	n/a	n/a
28	CREB1	chr16:74700465-74701204	GM12878	blood:	n/a	n/a
29	TCF3	chr16:74700573-74700820	GM12878	blood:	n/a	n/a
30	POLR2A	chr16:74700382-74701021	MCF-7	breast:	n/a	n/a
31	HCFC1	chr16:74700139-74702469	Hela-S3	cervix:	n/a	n/a
32	GABPA	chr16:74700479-74701156	HL-60	blood:	n/a	n/a
33	HEY1	chr16:74700084-74700986	K562	blood:	n/a	chr16:74700694-74700709
34	POLR2A	chr16:74700113-74701522	GM12878	blood:	n/a	n/a
35	ETS1	chr16:74700251-74700961	K562	blood:	n/a	chr16:74700773-74700783 chr16:74700775-74700784 chr16:74700775-74700784
36	TBP	chr16:74700519-74702049	HepG2	liver:	n/a	n/a
37	CEBPB	chr16:74700163-74701695	Hela-S3	cervix:	n/a	chr16:74700908-74700916
38	ZNF143	chr16:74700694-74701615	K562	blood:	n/a	chr16:74701498-74701508
39	POLR2A	chr16:74700113-74701706	K562	blood:	n/a	n/a
40	MYC	chr16:74700114-74701332	A549	lung:	n/a	chr16:74700459-74700468
41	SP2	chr16:74700592-74701029	K562	blood:	n/a	chr16:74700906-74700916 chr16:74700966-74700989
42	UBTF	chr16:74700328-74700958	K562	blood:	n/a	n/a
43	MYC	chr16:74700408-74700951	H1-hESC	embryonic stem cell:	n/a	chr16:74700459-74700468
44	TAF1	chr16:74700559-74700898	GM12892	blood:	n/a	n/a
45	TAF1	chr16:74700510-74700934	GM12891	blood:	n/a	n/a
46	POLR2A	chr16:74700296-74701009	HUVEC	blood vessel:	n/a	n/a
47	EP300	chr16:74700424-74700995	HepG2	liver:	n/a	chr16:74700776-74700783 chr16:74700456-74700472 chr16:74700691-74700707
48	RFX5	chr16:74700590-74701087	HepG2	liver:	n/a	chr16:74700907-74700916
49	EGR1	chr16:74700564-74700881	K562	blood:	n/a	chr16:74700775-74700784
50	MYC	chr16:74700488-74700822	K562	blood:	n/a	n/a

(count:61 , 50 per page) page: 1 2

No.	Chromosome Location	Cell Line	Cell type	Cell Stage
1	chr16:74700730-74700780	MCF10A-Er-Src	breast:	n/a
2	chr16:74700730-74700780	SK-N-SH	brain:	n/a
3	chr16:74700730-74700780	MCF-7	breast:	n/a
4	chr16:74700730-74700780	AoSMC	blood vessel:	n/a
5	chr16:74700730-74700780	HCM	heart:	n/a
6	chr16:74700730-74700780	AG04450	lung:	fetal
7	chr16:74700730-74700780	HCPEpiC	choroid plexus:	n/a
8	chr16:74700730-74700780	PrEC	prostate:	n/a
9	chr16:74700730-74700780	AG10803	skin:	n/a
10	chr16:74700730-74700780	Hepatocyte	liver:	n/a
11	chr16:74700730-74700780	GM12891	blood:	n/a
12	chr16:74700730-74700780	NHBE	bronchial:	n/a
13	chr16:74700730-74700780	RPTEC	kidney:	n/a
14	chr16:74700730-74700780	Hela-S3	cervix:	n/a
15	chr16:74700730-74700780	AG09319	gingival:	n/a
16	chr16:74700730-74700780	SAEC	small airway:	n/a
17	chr16:74700730-74700780	NH-A	brain:	n/a
18	chr16:74700730-74700780	K562	blood:	n/a
19	chr16:74700730-74700780	HRCEpiC	kidney:	n/a
20	chr16:74700730-74700780	LNCaP	prostate:	n/a
21	chr16:74700730-74700780	HepG2	liver:	n/a
22	chr16:74700730-74700780	NT2-D1	testis:	n/a
23	chr16:74700730-74700780	HAEpiC	amniotic membrane:	n/a
24	chr16:74700730-74700780	CMK	blood:	n/a
25	chr16:74700730-74700780	HCT-116	colon:	n/a
26	chr16:74700730-74700780	AG09309	skin:	n/a
27	chr16:74700730-74700780	HUVEC	blood vessel:	n/a
28	chr16:74700730-74700780	AG04449	skin:	fetal
29	chr16:74700730-74700780	Jurkat	blood:	n/a
30	chr16:74700730-74700780	HRE	kidney:	n/a
31	chr16:74700730-74700780	GM19239	blood:	n/a
32	chr16:74700730-74700780	HNPCEpiC	eye:	n/a
33	chr16:74700730-74700780	SKMC	muscle:	n/a
34	chr16:74700730-74700780	BJ	skin:	n/a
35	chr16:74700730-74700780	Caco-2	colon:	n/a
36	chr16:74700730-74700780	HL-60	blood:	n/a
37	chr16:74700730-74700780	H1-hESC	embryonic stem cell:	embryo
38	chr16:74700730-74700780	SK-N-SH_RA	brain:	n/a
39	chr16:74700730-74700780	ovcar-3	ovarian:	n/a
40	chr16:74700730-74700780	NB4	blood:	n/a
41	chr16:74700730-74700780	IMR90	lung:	fetal
42	chr16:74700730-74700780	NHDF-neo	bronchial:	n/a
43	chr16:74700730-74700780	ECC-1	luminal epithelium:	n/a
44	chr16:74700730-74700780	HPAEpiC	pulmonary alveolar:	n/a
45	chr16:74700730-74700780	HEEpiC	esophagus:	n/a
46	chr16:74700730-74700780	GM12878	blood:	n/a
47	chr16:74700730-74700780	HCF	heart:	n/a
48	chr16:74700730-74700780	GM12892	blood:	n/a
49	chr16:74700730-74700780	HIPEpiC	eye:	n/a
50	chr16:74700730-74700780	PFSK-1	brain:	n/a

(count:8 , 50 per page) page: 1

No.	Distal block	Cell Line	Cell type
1	chr16:74699432..74702199-chr16:74708943..74711933,3	MCF-7	breast:
2	chr16:74700450..74705009-chr16:74710570..74714672,7	MCF-7	breast:
3	chr1:149858235..149859084-chr16:74700340..74701108,2	Hela-S3	cervix:
4	chr16:74640131..74642133-chr16:74699118..74701416,2	MCF-7	breast:
5	chr16:74700257..74700957-chr2:86668009..86668562,2	Hela-S3	cervix:
6	chr16:74700318..74701202-chr2:110873506..110874030,2	HCT-116	colon:
7	chr16:74700283..74702840-chr16:74732685..74734980,2	MCF-7	breast:
8	chr16:74698718..74701799-chr16:74732753..74735845,3	MCF-7	breast:

No data

Variant related genes	Relation type
ENSG00000262904	TF binding region
RFWD3	TF binding region
RFWD3	CpG island
ENSG00000262904	CpG island
ENSG00000090863	Chromatin interaction
ENSG00000168404	Chromatin interaction
ENSG00000115548	Chromatin interaction
ENSG00000184260	Chromatin interaction
ENSG00000144063	Chromatin interaction

Extended variants
information (count: 102 )
Associated
traits (count: 0)

rSNPs within LD-proxies of this variant (count:91)

rs_ID	r²[population]
rs10400930	0.83[ASN][1000 genomes]
rs12716769	0.84[EUR][1000 genomes]
rs12921903	0.84[ASN][1000 genomes]
rs12935075	0.87[ASN][1000 genomes]
rs13339156	0.84[ASN][1000 genomes]
rs28377859	0.84[ASN][1000 genomes]
rs28502731	0.83[ASN][1000 genomes]
rs28681530	0.85[AMR][1000 genomes];0.90[EUR][1000 genomes]
rs4072222	0.95[AFR][1000 genomes];0.95[AMR][1000 genomes];0.92[EUR][1000 genomes];1.00[ASN][1000 genomes]
rs4243108	0.93[ASN][1000 genomes]
rs4271617	0.89[ASN][1000 genomes]
rs4286131	0.89[ASN][1000 genomes]
rs4287593	0.89[ASN][1000 genomes]
rs4302071	0.83[ASN][1000 genomes]
rs4462623	0.93[ASN][1000 genomes]
rs4476202	0.80[EUR][1000 genomes];0.82[ASN][1000 genomes]
rs4548905	0.83[ASN][1000 genomes]
rs4564599	0.88[ASN][1000 genomes]
rs4588013	0.88[ASN][1000 genomes]
rs4887776	0.83[ASN][1000 genomes]
rs4887777	0.83[ASN][1000 genomes]
rs4887779	0.83[ASN][1000 genomes]
rs4888258	0.83[ASN][1000 genomes]
rs4888259	0.82[ASN][1000 genomes]
rs4888262	0.83[AMR][1000 genomes];0.90[EUR][1000 genomes]
rs4888264	0.82[AMR][1000 genomes];0.90[EUR][1000 genomes]
rs4888265	0.83[AMR][1000 genomes];0.90[EUR][1000 genomes]
rs4888266	0.87[ASN][1000 genomes]
rs4888267	0.87[AMR][1000 genomes];0.91[EUR][1000 genomes]
rs4888270	0.96[ASN][1000 genomes]
rs4888271	0.84[AMR][1000 genomes];0.83[EUR][1000 genomes]
rs4888274	0.95[AFR][1000 genomes];0.95[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs56099065	0.83[AMR][1000 genomes]
rs58136167	0.99[ASN][1000 genomes]
rs6564146	0.81[ASN][1000 genomes]
rs6564147	0.82[ASN][1000 genomes]
rs6564148	0.82[ASN][1000 genomes]
rs6564149	0.83[ASN][1000 genomes]
rs6564152	0.85[ASN][1000 genomes]
rs6564153	0.85[ASN][1000 genomes]
rs6564154	0.89[ASN][1000 genomes]
rs6564155	0.90[ASN][1000 genomes]
rs6564157	0.95[ASN][1000 genomes]
rs7184754	0.88[ASN][1000 genomes]
rs7185722	0.85[ASN][1000 genomes]
rs7188880	0.89[EUR][1000 genomes]
rs7190631	0.84[ASN][1000 genomes]
rs7191665	0.87[AMR][1000 genomes];0.91[EUR][1000 genomes]
rs7193423	0.84[ASN][1000 genomes]
rs7193508	0.84[ASN][1000 genomes]
rs7193583	0.83[ASN][1000 genomes]
rs7193959	0.88[ASN][1000 genomes]
rs7194687	0.83[ASN][1000 genomes]
rs7195499	0.93[ASN][1000 genomes]
rs7196369	0.83[ASN][1000 genomes]
rs7201320	0.89[AMR][1000 genomes];0.94[EUR][1000 genomes]
rs7204382	0.92[ASN][1000 genomes]
rs7204804	0.85[ASN][1000 genomes]
rs7205258	0.81[ASN][1000 genomes]
rs7342732	0.96[ASN][1000 genomes]
rs8047243	0.80[ASN][1000 genomes]
rs8049056	0.83[ASN][1000 genomes]
rs8050615	0.80[ASN][1000 genomes]
rs8050624	0.90[ASN][1000 genomes]
rs8052367	0.81[AMR][1000 genomes];0.90[EUR][1000 genomes]
rs8052923	0.88[ASN][1000 genomes]
rs8053084	0.81[ASN][1000 genomes]
rs8055784	0.95[ASN][1000 genomes]
rs8055803	0.80[ASN][1000 genomes]
rs8056718	0.82[ASN][1000 genomes]
rs8057279	0.84[ASN][1000 genomes]
rs8058034	0.83[ASN][1000 genomes]
rs8058133	0.81[AMR][1000 genomes];0.87[EUR][1000 genomes]
rs8058437	0.80[ASN][1000 genomes]
rs8058922	0.89[ASN][1000 genomes]
rs8059780	0.84[AMR][1000 genomes];0.89[EUR][1000 genomes]
rs8061942	0.88[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs8062404	0.82[ASN][1000 genomes]
rs8062783	0.89[AMR][1000 genomes];0.92[EUR][1000 genomes]
rs8062959	0.84[ASN][1000 genomes]
rs9921672	0.81[ASN][1000 genomes]
rs9922988	0.82[EUR][1000 genomes]
rs9923145	0.87[AMR][1000 genomes];0.90[EUR][1000 genomes]
rs9925807	0.83[ASN][1000 genomes]
rs9927073	0.80[ASN][1000 genomes]
rs9928181	0.83[ASN][1000 genomes]
rs9929483	0.98[ASN][1000 genomes]
rs9929496	0.89[EUR][1000 genomes]
rs9929931	0.85[EUR][1000 genomes]
rs9931225	0.92[AMR][1000 genomes];0.94[EUR][1000 genomes];0.93[ASN][1000 genomes]
rs9938833	0.87[ASN][1000 genomes]

Variant overlapped rSNPs/rCNVs (count:11 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv916687	chr16:74241238-74896721	Weak transcription Flanking Active TSS Flanking Bivalent TSS/Enh Enhancers Strong transcription Transcr. at gene 5' and 3' Genic enhancers Active TSS Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	102 gene(s)	inside rSNPs	diseases
2	nsv949374	chr16:74466960-75172358	Enhancers Flanking Active TSS Weak transcription Strong transcription Bivalent/Poised TSS Bivalent Enhancer Transcr. at gene 5' and 3' Genic enhancers Active TSS ZNF genes & repeats Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	96 gene(s)	inside rSNPs	diseases
3	nsv1062517	chr16:74483574-74710623	Enhancers Strong transcription Weak transcription Active TSS Genic enhancers Transcr. at gene 5' and 3' Flanking Active TSS ZNF genes & repeats Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	23 gene(s)	inside rSNPs	diseases
4	nsv1061095	chr16:74519718-75407020	Strong transcription Enhancers Flanking Active TSS Weak transcription Genic enhancers Active TSS Bivalent Enhancer Flanking Bivalent TSS/Enh ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	123 gene(s)	inside rSNPs	diseases
5	esv275138	chr16:74647795-74722907	Weak transcription Strong transcription Enhancers Active TSS Genic enhancers Transcr. at gene 5' and 3' Flanking Active TSS Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	12 gene(s)	inside rSNPs	diseases
6	esv2760414	chr16:74647795-74741615	Weak transcription Flanking Active TSS Enhancers Strong transcription Genic enhancers Active TSS Flanking Bivalent TSS/Enh Transcr. at gene 5' and 3' Bivalent/Poised TSS Bivalent Enhancer ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	37 gene(s)	inside rSNPs	diseases
7	nsv1061948	chr16:74660609-74882915	Enhancers Weak transcription Active TSS Flanking Active TSS Bivalent Enhancer Strong transcription Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	67 gene(s)	inside rSNPs	diseases
8	nsv542957	chr16:74660609-74882915	Enhancers Genic enhancers Weak transcription Flanking Active TSS Active TSS Flanking Bivalent TSS/Enh Strong transcription Bivalent Enhancer Bivalent/Poised TSS ZNF genes & repeats Transcr. at gene 5' and 3'	TF binding region CpG island Chromatin interactive region lncRNA	67 gene(s)	inside rSNPs	diseases
9	nsv906906	chr16:74664743-74805668	Active TSS Flanking Active TSS Enhancers Weak transcription Strong transcription Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS ZNF genes & repeats Bivalent Enhancer Flanking Bivalent TSS/Enh	TF binding region CpG island Chromatin interactive region lncRNA	57 gene(s)	inside rSNPs	diseases
10	nsv572975	chr16:74677312-74702254	Weak transcription Flanking Active TSS Enhancers Strong transcription Active TSS Genic enhancers ZNF genes & repeats Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh Bivalent Enhancer	TF binding region CpG island Chromatin interactive region lncRNA	8 gene(s)	inside rSNPs	diseases
11	nsv532560	chr16:74692406-75411912	Enhancers Weak transcription Genic enhancers Flanking Active TSS Strong transcription Active TSS Bivalent Enhancer Transcr. at gene 5' and 3' Bivalent/Poised TSS Flanking Bivalent TSS/Enh ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA miRNA target site	111 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:127 , 50 per page) page: 1 2 3

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr16:74699200-74701600	Active TSS	GM12878-XiMat	blood
2	chr16:74699400-74701400	Active TSS	H9 Derived Neuronal Progenitor Cultured Cells	ES cell derived
3	chr16:74699400-74701400	Active TSS	NHEK	skin
4	chr16:74699400-74701800	Active TSS	hESC Derived CD56+ Mesoderm Cultured Cells	ES cell derived
5	chr16:74699400-74701800	Active TSS	Foreskin Fibroblast Primary Cells skin02	Skin
6	chr16:74699400-74702000	Active TSS	H1 Cell Line	embryonic stem cell
7	chr16:74699400-74702000	Active TSS	H9 Cell Line	embryonic stem cell
8	chr16:74699600-74701200	Active TSS	Fetal Thymus	thymus
9	chr16:74699600-74701400	Active TSS	A549	lung
10	chr16:74699600-74701400	Active TSS	HMEC	breast
11	chr16:74699600-74701400	Active TSS	NH-A	brain
12	chr16:74699600-74701600	Active TSS	iPS-15b Cell Line	embryonic stem cell
13	chr16:74699600-74701600	Active TSS	iPS-18 Cell Line	embryonic stem cell
14	chr16:74699600-74701600	Active TSS	Foreskin Melanocyte Primary Cells skin01	Skin
15	chr16:74699600-74701600	Active TSS	Hela-S3	cervix
16	chr16:74699600-74701600	Active TSS	NHLF	lung
17	chr16:74699600-74701800	Active TSS	iPS DF 19.11 Cell Line	embryonic stem cell
18	chr16:74699600-74701800	Active TSS	Fetal Brain Female	brain
19	chr16:74699600-74701800	Active TSS	HSMM	muscle
20	chr16:74699600-74702000	Active TSS	HUES64 Cell Line	embryonic stem cell
21	chr16:74699600-74702000	Active TSS	Foreskin Fibroblast Primary Cells skin01	Skin
22	chr16:74699600-74702000	Active TSS	Foreskin Melanocyte Primary Cells skin03	Skin
23	chr16:74699600-74702200	Active TSS	iPS-20b Cell Line	embryonic stem cell
24	chr16:74699800-74700800	Active TSS	H1 Derived Neuronal Progenitor Cultured Cells	ES cell derived
25	chr16:74699800-74701200	Active TSS	hESC Derived CD184+ Endoderm Cultured Cells	ES cell derived
26	chr16:74699800-74701400	Active TSS	Muscle Satellite Cultured Cells	--
27	chr16:74699800-74701600	Active TSS	HUES48 Cell Line	embryonic stem cell
28	chr16:74699800-74701600	Active TSS	Primary T cells from cord blood	blood
29	chr16:74699800-74701600	Active TSS	Brain Dorsolateral Prefrontal Cortex	brain
30	chr16:74699800-74701600	Active TSS	Esophagus	oesophagus
31	chr16:74699800-74701600	Active TSS	Fetal Kidney	kidney
32	chr16:74699800-74701600	Active TSS	K562	blood
33	chr16:74699800-74701800	Active TSS	H1 BMP4 Derived Mesendoderm Cultured Cells	ES cell derived
34	chr16:74699800-74701800	Active TSS	hESC Derived CD56+ Ectoderm Cultured Cells	ES cell derived
35	chr16:74699800-74701800	Active TSS	IMR90 fetal lung fibroblasts Cell Line	lung
36	chr16:74699800-74701800	Active TSS	iPS DF 6.9 Cell Line	embryonic stem cell
37	chr16:74699800-74701800	Active TSS	Mesenchymal Stem Cell Derived Adipocyte Cultured Cells	ES cell derived
38	chr16:74699800-74701800	Active TSS	Colonic Mucosa	Colon
39	chr16:74699800-74701800	Active TSS	Fetal Intestine Large	intestine
40	chr16:74699800-74701800	Active TSS	Left Ventricle	heart
41	chr16:74699800-74701800	Active TSS	Right Atrium	heart
42	chr16:74699800-74701800	Active TSS	Right Ventricle	heart
43	chr16:74699800-74701800	Active TSS	HSMMtube	muscle
44	chr16:74699800-74701800	Active TSS	NHDF-Ad	bronchial
45	chr16:74699800-74702000	Active TSS	Adipose Derived Mesenchymal Stem Cell Cultured Cells	ES cell derived
46	chr16:74699800-74702000	Active TSS	Bone Marrow Derived Cultured Mesenchymal Stem Cells	Bone marrow
47	chr16:74699800-74702000	Active TSS	Rectal Smooth Muscle	rectum
48	chr16:74699800-74702200	Active TSS	HUES6 Cell Line	embryonic stem cell
49	chr16:74699800-74702200	Active TSS	Psoas Muscle	Psoas
50	chr16:74699800-74702400	Active TSS	ES-I3 Cell Line	embryonic stem cell

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links