Variant report

Variant rs58529385
Chromosome Location chr9:139622449-139622450
allele -/CCCCATCCCGCGGCTCGCGC
Outlinks Ensembl   UCSC
Chromatin state (count:127 , 50 per page) page: 1 2 3
No. Chromosome Location Chromatin state Cell line Tissue
1 chr9:139620000-139623000 Transcr. at gene 5' and 3' iPS DF 19.11 Cell Line embryonic stem cell
2 chr9:139620400-139623400 Active TSS Pancreatic Islets Pancreatic Islet
3 chr9:139620600-139623800 Active TSS H1 BMP4 Derived Mesendoderm Cultured Cells ES cell derived
4 chr9:139621000-139622600 Flanking Active TSS Primary hematopoietic stem cells blood
5 chr9:139621200-139623000 Active TSS GM12878-XiMat blood
6 chr9:139621200-139623400 Active TSS Lung lung
7 chr9:139621400-139622800 Active TSS Pancreas Pancrea
8 chr9:139621400-139623000 Active TSS H1 BMP4 Derived Trophoblast Cultured Cells ES cell derived
9 chr9:139621400-139623000 Active TSS H1 Derived Neuronal Progenitor Cultured Cells ES cell derived
10 chr9:139621400-139623000 Active TSS ES-UCSF4 Cell Line embryonic stem cell
11 chr9:139621400-139623200 Active TSS Foreskin Melanocyte Primary Cells skin01 Skin
12 chr9:139621400-139623200 Active TSS Ovary ovary
13 chr9:139621400-139623200 Active TSS Right Ventricle heart
14 chr9:139621400-139623200 Active TSS HSMMtube muscle
15 chr9:139621400-139623400 Active TSS Gastric stomach
16 chr9:139621400-139623600 Flanking Active TSS Primary mononuclear cells fromperipheralblood Blood
17 chr9:139621400-139623600 Active TSS Psoas Muscle Psoas
18 chr9:139621400-139623800 Active TSS ES-WA7 Cell Line embryonic stem cell
19 chr9:139621600-139622800 Active TSS ES-I3 Cell Line embryonic stem cell
20 chr9:139621600-139622800 Active TSS hESC Derived CD56+ Ectoderm Cultured Cells ES cell derived
21 chr9:139621600-139622800 Active TSS Primary T cells effector/memory enriched fromperipheralblood blood
22 chr9:139621600-139622800 Active TSS HMEC breast
23 chr9:139621600-139623000 Active TSS HUES64 Cell Line embryonic stem cell
24 chr9:139621600-139623000 Active TSS iPS-18 Cell Line embryonic stem cell
25 chr9:139621600-139623000 Active TSS Muscle Satellite Cultured Cells --
26 chr9:139621600-139623000 Active TSS Foreskin Fibroblast Primary Cells skin02 Skin
27 chr9:139621600-139623000 Active TSS Thymus Thymus
28 chr9:139621600-139623000 Active TSS Hela-S3 cervix
29 chr9:139621600-139623200 Active TSS H1 Cell Line embryonic stem cell
30 chr9:139621600-139623200 Active TSS IMR90 fetal lung fibroblasts Cell Line lung
31 chr9:139621600-139623200 Active TSS Mesenchymal Stem Cell Derived Chondrocyte Cultured Cells embryonic stem cell
32 chr9:139621600-139623200 Active TSS Sigmoid Colon Sigmoid Colon
33 chr9:139621600-139623400 Active TSS hESC Derived CD56+ Mesoderm Cultured Cells ES cell derived
34 chr9:139621600-139623400 Active TSS HUES48 Cell Line embryonic stem cell
35 chr9:139621600-139623400 Active TSS HUES6 Cell Line embryonic stem cell
36 chr9:139621600-139623400 Active TSS iPS-15b Cell Line embryonic stem cell
37 chr9:139621600-139623400 Active TSS iPS DF 6.9 Cell Line embryonic stem cell
38 chr9:139621600-139623400 Active TSS Mesenchymal Stem Cell Derived Adipocyte Cultured Cells ES cell derived
39 chr9:139621600-139623400 Active TSS Breast variant Human Mammary Epithelial Cells (vHMEC) Breast
40 chr9:139621600-139623400 Active TSS Brain Angular Gyrus brain
41 chr9:139621600-139623400 Active TSS Brain Hippocampus Middle brain
42 chr9:139621600-139623400 Active TSS Esophagus oesophagus
43 chr9:139621600-139623400 Active TSS Fetal Intestine Large intestine
44 chr9:139621600-139623400 Active TSS Fetal Intestine Small intestine
45 chr9:139621600-139623400 Active TSS Left Ventricle heart
46 chr9:139621600-139623400 Active TSS NHEK skin
47 chr9:139621600-139623600 Active TSS H9 Cell Line embryonic stem cell
48 chr9:139621600-139623600 Active TSS hESC Derived CD184+ Endoderm Cultured Cells ES cell derived
49 chr9:139621600-139623600 Active TSS Adipose Derived Mesenchymal Stem Cell Cultured Cells ES cell derived
50 chr9:139621600-139623600 Active TSS Colon Smooth Muscle Colon

Quick Search:


  
Input of quick search could be:

what's new

Quick links