Variant report

Variant	rs371760789
Chromosome Location	chr5:27434264-27434265
allele	-/AAGGTGAGTTTTGTATTTGT
Outlinks	Ensembl UCSC

Chromatin state
Related regulatory elements
Target genes
Other information

Extended variants
information (count: 27 )
Associated
traits (count: 0)

Variant overlapped rSNPs/rCNVs (count:27 , 50 per page) page: 1

No.	Variant name	Chromosome position	Chromatin state	Related regulatory elements	Target genes	Extended variants	Associated traits
1	nsv881286	chr5:27135351-27770554	Weak transcription Enhancers Strong transcription Flanking Active TSS ZNF genes & repeats Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
2	nsv880298	chr5:27193573-27659111	Enhancers Weak transcription ZNF genes & repeats Strong transcription Active TSS Transcr. at gene 5' and 3' Flanking Active TSS Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
3	nsv880326	chr5:27193573-27743375	Transcr. at gene 5' and 3' Strong transcription Enhancers Weak transcription Flanking Active TSS Active TSS ZNF genes & repeats Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
4	nsv880623	chr5:27279981-27559659	Enhancers ZNF genes & repeats Strong transcription Active TSS Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
5	nsv880525	chr5:27308254-27447863	Enhancers Active TSS Flanking Active TSS Weak transcription Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
6	nsv881318	chr5:27323746-27559659	Active TSS Enhancers Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Weak transcription ZNF genes & repeats Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
7	nsv880317	chr5:27328631-27447863	Weak transcription Enhancers Active TSS Strong transcription ZNF genes & repeats	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
8	nsv881503	chr5:27344037-27510050	Active TSS ZNF genes & repeats Enhancers Weak transcription Flanking Active TSS Strong transcription Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
9	nsv881216	chr5:27361816-27464184	Enhancers Weak transcription Active TSS ZNF genes & repeats Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
10	nsv881475	chr5:27376682-27510050	Strong transcription Enhancers ZNF genes & repeats Weak transcription Flanking Active TSS Active TSS Genic enhancers Transcr. at gene 5' and 3' Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
11	nsv881003	chr5:27376682-27539490	Enhancers ZNF genes & repeats Weak transcription Active TSS Transcr. at gene 5' and 3' Strong transcription Flanking Active TSS Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
12	nsv880935	chr5:27376682-27559659	Weak transcription Active TSS Strong transcription Transcr. at gene 5' and 3' Enhancers ZNF genes & repeats Flanking Active TSS Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
13	nsv880535	chr5:27376682-27706007	ZNF genes & repeats Enhancers Weak transcription Flanking Active TSS Active TSS Transcr. at gene 5' and 3' Strong transcription Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
14	nsv881089	chr5:27387385-27478198	ZNF genes & repeats Enhancers Active TSS Flanking Active TSS Genic enhancers Weak transcription Transcr. at gene 5' and 3' Strong transcription Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	13 gene(s)	inside rSNPs	diseases
15	nsv880442	chr5:27388559-27459928	Enhancers Active TSS Weak transcription ZNF genes & repeats Flanking Active TSS	TF binding region CpG island Chromatin interactive region lncRNA	3 gene(s)	inside rSNPs	diseases
16	nsv881139	chr5:27388559-27539490	ZNF genes & repeats Weak transcription Active TSS Flanking Active TSS Genic enhancers Enhancers Transcr. at gene 5' and 3' Strong transcription Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
17	nsv880496	chr5:27388559-27559659	Active TSS Enhancers Strong transcription Weak transcription ZNF genes & repeats Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
18	nsv880940	chr5:27388559-27611431	Enhancers Active TSS ZNF genes & repeats Weak transcription Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers Strong transcription Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
19	nsv880999	chr5:27388559-27770554	Flanking Active TSS Active TSS ZNF genes & repeats Weak transcription Enhancers Strong transcription Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
20	nsv880926	chr5:27401935-27539490	Enhancers Weak transcription ZNF genes & repeats Active TSS Flanking Active TSS Strong transcription Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
21	nsv881221	chr5:27401935-27660532	Transcr. at gene 5' and 3' ZNF genes & repeats Weak transcription Active TSS Strong transcription Flanking Active TSS Enhancers Bivalent/Poised TSS Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
22	nsv881125	chr5:27406164-27622177	Enhancers Strong transcription Active TSS Flanking Active TSS Weak transcription ZNF genes & repeats Bivalent/Poised TSS Transcr. at gene 5' and 3' Genic enhancers	TF binding region CpG island Chromatin interactive region lncRNA	16 gene(s)	inside rSNPs	diseases
23	nsv880660	chr5:27418887-27510050	Weak transcription Enhancers Flanking Active TSS ZNF genes & repeats Active TSS Transcr. at gene 5' and 3' Strong transcription Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
24	nsv880726	chr5:27424981-27539490	Enhancers Weak transcription Active TSS Strong transcription ZNF genes & repeats Flanking Active TSS Transcr. at gene 5' and 3' Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
25	nsv880474	chr5:27424981-27559659	Flanking Active TSS Enhancers Active TSS Weak transcription Strong transcription Transcr. at gene 5' and 3' ZNF genes & repeats Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
26	nsv880869	chr5:27424981-27684515	Weak transcription Enhancers Active TSS Flanking Active TSS ZNF genes & repeats Transcr. at gene 5' and 3' Strong transcription Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases
27	nsv597681	chr5:27426728-27526060	Weak transcription ZNF genes & repeats Enhancers Active TSS Strong transcription Transcr. at gene 5' and 3' Flanking Active TSS Genic enhancers Bivalent/Poised TSS	TF binding region CpG island Chromatin interactive region lncRNA	14 gene(s)	inside rSNPs	diseases

No data

Chromatin state (count:2 , 50 per page) page: 1

No.	Chromosome Location	Chromatin state	Cell line	Tissue
1	chr5:27434000-27435200	Enhancers	Foreskin Keratinocyte Primary Cells skin03	Skin
2	chr5:27434200-27435200	Enhancers	NHEK	skin

The 2.0 version of rSNPBase

Variant report

Quick Search:

what's new

Quick links